ID: 1070127585

View in Genome Browser
Species Human (GRCh38)
Location 10:73634579-73634601
Sequence TCTGATCAGCAGCACCATCT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 328
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 308}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070127585_1070127587 -9 Left 1070127585 10:73634579-73634601 CCCAGATGGTGCTGCTGATCAGA 0: 1
1: 0
2: 0
3: 19
4: 308
Right 1070127587 10:73634593-73634615 CTGATCAGAGCCATACTGTCCGG 0: 1
1: 0
2: 0
3: 6
4: 127
1070127585_1070127590 14 Left 1070127585 10:73634579-73634601 CCCAGATGGTGCTGCTGATCAGA 0: 1
1: 0
2: 0
3: 19
4: 308
Right 1070127590 10:73634616-73634638 CAGAGCCACTGCCCCCTGCCTGG 0: 1
1: 1
2: 9
3: 222
4: 3189

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070127585 Original CRISPR TCTGATCAGCAGCACCATCT GGG (reversed) Exonic
902732505 1:18378511-18378533 TCTGTTCAGTAGCAGCAACTGGG + Intergenic
903890796 1:26569138-26569160 TCTCGCCAGCAGCACAATCTTGG - Intronic
904037817 1:27568275-27568297 TCTGATTACCCGCACCCTCTAGG - Intronic
904438398 1:30514195-30514217 TCTTCTCAGCAGAGCCATCTGGG + Intergenic
905808820 1:40897074-40897096 TCTGTGCAGCGGCGCCATCTCGG + Intergenic
906127606 1:43437166-43437188 TCTCATCAGCAGCATAATCTGGG - Exonic
911569820 1:99508493-99508515 TCTGCACAGCCGCCCCATCTGGG + Intergenic
912508368 1:110172075-110172097 GATGATCAGCAGCACCAGGTAGG - Exonic
912966860 1:114243185-114243207 TCTGCCCAGCCGCCCCATCTGGG + Intergenic
913078249 1:115359796-115359818 TCTGCCCAGCCGCCCCATCTGGG - Intergenic
913078447 1:115360453-115360475 TCTGCCCAGCTGCCCCATCTGGG - Intergenic
913078538 1:115360795-115360817 TCTGCCCAGCCGCACCATCTGGG - Intergenic
916759877 1:167806479-167806501 TCTGCCCAGCAGCCCCGTCTGGG - Intergenic
918602676 1:186381923-186381945 TCTGATCATTAGTATCATCTTGG - Intronic
919930100 1:202215507-202215529 TCTGATCTCCAGCTCCATCTAGG - Intronic
920529528 1:206691789-206691811 TCTGACCATCAGCAGTATCTGGG + Intronic
922458409 1:225796195-225796217 TCTGCCCAGCCGCCCCATCTGGG - Intergenic
923124809 1:231025831-231025853 ACTGAGCATCAGCATCATCTGGG - Intronic
923502576 1:234578343-234578365 TCAGACCAGCAGCACCAGCGTGG + Intergenic
923684409 1:236143638-236143660 TCTGATGAGCGGCAGCAGCTCGG - Intronic
1064220011 10:13432297-13432319 TCTGATCAAAAGCTCCCTCTTGG + Intergenic
1066141140 10:32505718-32505740 TCTGCCCAGCCGCCCCATCTGGG - Intronic
1067086658 10:43243698-43243720 TCTGCCCAGCCGCCCCATCTGGG + Intronic
1068967561 10:62928804-62928826 TCTGCTCGGCCGCCCCATCTGGG - Intergenic
1069375483 10:67788634-67788656 TCTGATCCTCAGCTCCATCTTGG - Intergenic
1069674728 10:70239208-70239230 TCTGCCCAGCTGCCCCATCTGGG - Intergenic
1069674735 10:70239245-70239267 TCTGATTGGCCGCCCCATCTGGG - Intergenic
1070127585 10:73634579-73634601 TCTGATCAGCAGCACCATCTGGG - Exonic
1070376438 10:75835869-75835891 ACTGAACTGCAGCACCATTTTGG - Intronic
1071530261 10:86385438-86385460 TCTGCTCTGCAGCACCACTTTGG - Intergenic
1071599444 10:86950649-86950671 TCAGATCAGCTGCATCTTCTTGG - Intronic
1072481009 10:95809747-95809769 TCTGCCCAGCCGCCCCATCTGGG - Intronic
1072481171 10:95810326-95810348 TCTGCCCAGCCGCCCCATCTGGG - Intronic
1073320633 10:102614205-102614227 TGTGATCAGCAGGAGCTTCTGGG - Intronic
1074938330 10:118209344-118209366 TCTGATCAGCAGCTGCAACATGG - Intergenic
1075353067 10:121743686-121743708 TCTGAACAGCAGCATCCGCTCGG + Exonic
1077397501 11:2332388-2332410 TCTGACCCGCCGCCCCATCTGGG + Intergenic
1078522909 11:12077673-12077695 GCTGTTCAGCAAGACCATCTGGG - Intergenic
1078910762 11:15729769-15729791 TCTGAACAGCAGGTCCATCAAGG - Intergenic
1080874659 11:36264830-36264852 TCGTCTCAGCTGCACCATCTGGG - Intergenic
1080983137 11:37431419-37431441 TCTGCCCAGCCGCTCCATCTGGG - Intergenic
1081638472 11:44736673-44736695 TCTGATATGCAGCCTCATCTGGG + Intronic
1083871279 11:65489899-65489921 CCTGAACAGCAGCAGCAGCTGGG + Intergenic
1085716836 11:78879911-78879933 TCTGCCCAGCTGCCCCATCTGGG + Intronic
1087192527 11:95270070-95270092 TCTGATCTGCAGAACAATCTGGG + Intergenic
1088532700 11:110827938-110827960 TCTTTTCAGCAGGACCATTTAGG - Intergenic
1090138807 11:124230450-124230472 GCTGATAATCAGCATCATCTAGG - Intergenic
1090351532 11:126111387-126111409 GCTGATTTGCAGCACCCTCTGGG + Intergenic
1092596873 12:10016156-10016178 TATGACCAGCAGCACCCTTTTGG - Intronic
1092813237 12:12290826-12290848 CCAGACCAGCAGCACCACCTAGG - Intergenic
1097977239 12:65699921-65699943 TCTTATAAGCAGCATTATCTTGG - Intergenic
1098375306 12:69807747-69807769 TCTGCCCAGCCGCCCCATCTGGG - Intronic
1099193085 12:79581000-79581022 TCTAATCAGGAGCACAATTTGGG + Intronic
1101938952 12:109084601-109084623 TCTCAACAGCAGCACCATGATGG - Intronic
1102632312 12:114291873-114291895 TCTGATCAACACCTCCAGCTTGG - Intergenic
1104866953 12:131961417-131961439 GCAGATCAGCAGCATCATCCAGG + Exonic
1104885502 12:132104785-132104807 GCAGATCAGCAGCATCATCCAGG + Exonic
1105800780 13:23901476-23901498 TCTGATGAGCAGCCACACCTTGG - Intronic
1108904909 13:55456769-55456791 TGTAGTCAGCTGCACCATCTAGG + Intergenic
1108939709 13:55937657-55937679 TCAAATCAGCATCACCATGTTGG + Intergenic
1111770705 13:92592298-92592320 TCTGATCAGTTGCATCTTCTTGG - Intronic
1111770839 13:92593692-92593714 TCTGATCAGTTGCATCTTCTTGG - Intronic
1113448381 13:110387801-110387823 TCTGAGCAGCTGCAGCAGCTGGG - Intronic
1113521801 13:110946854-110946876 CCTGGACAGCAGCACAATCTGGG + Intergenic
1114572916 14:23687144-23687166 TCTGAACAGCAGCCACCTCTGGG + Intergenic
1114687990 14:24553368-24553390 TCTAAGCATCAGCACCATCCAGG - Intergenic
1117404061 14:55384854-55384876 GCTGATCAGCAGCAGCATCAGGG + Intronic
1117546724 14:56798871-56798893 TGAGATTAGCAGCACCATGTGGG + Intergenic
1118430839 14:65717401-65717423 TCTGCCCAGCTGCCCCATCTGGG - Intronic
1120847191 14:89137346-89137368 TCTTAGCATCAGCACCAGCTGGG - Intronic
1120953786 14:90063927-90063949 GCTGATGGGCCGCACCATCTGGG - Intronic
1121208355 14:92187931-92187953 TCTGCCCAGCCGCCCCATCTGGG - Intergenic
1121414103 14:93767150-93767172 TCTGATCAGTATCACCTTCTTGG - Intronic
1121628826 14:95408010-95408032 TGTGATCATCAGCGTCATCTGGG + Intronic
1121631995 14:95428035-95428057 TCCAATCAGATGCACCATCTTGG - Intronic
1123772445 15:23541724-23541746 TCTGGTGACCAGCCCCATCTAGG + Intergenic
1125031702 15:35081754-35081776 TCTGCCCAGCCGCCCCATCTGGG + Intergenic
1125901351 15:43350982-43351004 TCTTATGACCAGCACCATTTCGG + Exonic
1126549866 15:49916480-49916502 TCTGATCATAAGCTTCATCTAGG + Intronic
1127088786 15:55447096-55447118 TCTGCGCAGCCGCCCCATCTGGG - Intronic
1128835139 15:70803419-70803441 TCTGTTCAGAAACACCTTCTGGG + Intergenic
1128839507 15:70838551-70838573 TATCACCAGCAGCACCACCTGGG + Intronic
1130904560 15:88231027-88231049 TCTAATCAGCAGACCCATGTTGG - Intronic
1133921647 16:10158827-10158849 TGTGACCAGCACCTCCATCTAGG - Intronic
1134557393 16:15177255-15177277 TCGGCTCAGTGGCACCATCTTGG - Intergenic
1134583518 16:15391793-15391815 TCTGATCCGCAGTAACATCTAGG - Intergenic
1134586453 16:15415610-15415632 TTTGATCTGCAGTAACATCTAGG - Intronic
1134917964 16:18088964-18088986 TCGGCTCAGTGGCACCATCTTGG - Intergenic
1135315011 16:21437228-21437250 TTTGATCCGCAGTAACATCTAGG - Intronic
1135367937 16:21869496-21869518 TTTGATCCGCAGTAACATCTAGG - Intronic
1135443880 16:22501653-22501675 TTTGATCCGCAGTAACATCTAGG + Intronic
1135694496 16:24574845-24574867 TCTGCTCCGCCGCCCCATCTGGG - Intergenic
1135694534 16:24575001-24575023 TCTGCTCCGCCGCCCCATCTGGG - Intergenic
1135953116 16:26933859-26933881 CTTGACCAGCAGCACCAGCTAGG + Intergenic
1136192760 16:28627569-28627591 TTTGATCCGCAGTAACATCTAGG + Intergenic
1136325124 16:29517684-29517706 TTTGATCCGCAGTAACATCTAGG - Intergenic
1136439809 16:30257666-30257688 TTTGATCCGCAGTAACATCTAGG - Intergenic
1137388141 16:48059340-48059362 TCTGCCCAGCCGCCCCATCTGGG - Intergenic
1138215541 16:55201824-55201846 TCTGCTGAGCATCACCATTTGGG + Intergenic
1139859205 16:70006932-70006954 TCTGATCCGCAGTAACATCTAGG - Intergenic
1139886309 16:70209965-70209987 TTTGATCTGCAGTAACATCTAGG - Intergenic
1140486663 16:75299051-75299073 GGTGATCAGCAGCAGCAGCTTGG - Intronic
1140946575 16:79773923-79773945 TCTGATCAGAAACATCACCTGGG - Intergenic
1141684898 16:85564626-85564648 GTTGCTCAGCAGCACCCTCTAGG + Intergenic
1142109934 16:88325840-88325862 TCTGCCCTGCAGCCCCATCTGGG - Intergenic
1142282935 16:89158915-89158937 CCTGATCAGACGCACCATGTAGG - Intergenic
1144509976 17:15867386-15867408 TCTGCTCTGCCGCCCCATCTGGG + Intergenic
1145794929 17:27649944-27649966 GCTGATCCGAAGCACCGTCTGGG + Intergenic
1145928809 17:28669240-28669262 TCGGTGCAGTAGCACCATCTTGG + Intronic
1146514497 17:33478833-33478855 TCTGTTTAGCAGAAGCATCTAGG - Intronic
1146925286 17:36740212-36740234 TCTCCTCAGCAGCCCGATCTGGG + Intergenic
1147333034 17:39710012-39710034 CCTCATCAGCATCACCTTCTAGG - Intronic
1148510628 17:48166388-48166410 TATCATCAGTAGCACCAACTTGG - Intronic
1148672224 17:49419687-49419709 TCTGCCCAGCCGCCCCATCTGGG - Intronic
1150375028 17:64673963-64673985 CCTGATGAGCAGCATCACCTGGG - Intergenic
1150914456 17:69422580-69422602 TGTGATCAGCAGCTCCACCTGGG - Intronic
1151887915 17:76933986-76934008 ACTGCTCATCAGCTCCATCTTGG + Intronic
1154319114 18:13330740-13330762 TCTGGTGACCAGCCCCATCTTGG - Intronic
1154420264 18:14223004-14223026 TCTGTCCAGCCGCCCCATCTGGG + Intergenic
1154420295 18:14223118-14223140 TCTGCCCAGCCGCCCCATCTGGG + Intergenic
1154420342 18:14223309-14223331 TCTGCCCAGCCGCCCCATCTGGG + Intergenic
1154482991 18:14855508-14855530 TCTGCCCAGCCGCCCCATCTGGG - Intergenic
1154483340 18:14856870-14856892 TCTGCCCAGCCGCCCCATCTGGG - Intergenic
1154483349 18:14856907-14856929 TCTGCCCAGCTGCCCCATCTGGG - Intergenic
1154483760 18:14858490-14858512 TCTGCCCAGCCGCCCCATCTGGG - Intergenic
1154483769 18:14858527-14858549 TCTGCCCAGCTGCCCCATCTGGG - Intergenic
1154484181 18:14860110-14860132 TCTGCCCAGCCGCCCCATCTGGG - Intergenic
1157197126 18:45628559-45628581 TCTGACCATCAGAAGCATCTAGG - Intronic
1157378334 18:47187481-47187503 ACTGATCATCAGAATCATCTAGG + Intergenic
1158438846 18:57455641-57455663 TCTGATCCACAGGAGCATCTCGG + Intronic
1161655215 19:5510207-5510229 ACTGCTCAGCAGGGCCATCTTGG - Intergenic
1161948526 19:7454091-7454113 TGGGATTAGCAGCACCATCTTGG + Intronic
1161948549 19:7454190-7454212 TTGGATCAGTGGCACCATCTTGG + Intronic
1162027990 19:7904949-7904971 TCTGATCAGTCCCACCACCTCGG + Intronic
1164016791 19:21261018-21261040 TCTGCCCAGCCGCCCCATCTGGG - Intronic
1164161430 19:22627825-22627847 TCTCAGCAGCAGCAGCAGCTTGG + Intergenic
1164217183 19:23160808-23160830 TCTGCCCGGCAGCCCCATCTGGG - Intergenic
1164452475 19:28378618-28378640 TCTGATCATCAGAATTATCTAGG - Intergenic
1164654667 19:29911474-29911496 GCTGATCATCAGAACCACCTGGG - Intergenic
1165798730 19:38534784-38534806 GATCATCTGCAGCACCATCTCGG - Exonic
1165845871 19:38817259-38817281 TCGGAGCAGCAGCCCCACCTGGG + Intronic
1167202966 19:48079908-48079930 TCAGTGCAGCAGCACGATCTCGG - Intronic
925246864 2:2391233-2391255 TGTGATCAGCAGAACCCTGTGGG - Intergenic
927737230 2:25534847-25534869 TCTGCCCAGCCGCCCCATCTGGG - Intronic
931794479 2:65696171-65696193 TCTGATCAGCTGTGTCATCTAGG + Intergenic
931905175 2:66834774-66834796 TCTGTTCAGCAGCTTCATCTGGG + Intergenic
933868514 2:86545723-86545745 TCTGCCCAGCCGCCCCATCTGGG - Intronic
935639502 2:105277613-105277635 CCTGAACTGCAGCAGCATCTTGG + Exonic
936092817 2:109511962-109511984 TCTGGGCAGCAACACCATCTAGG - Intergenic
937263158 2:120599190-120599212 TTTGAACAGCAGCAACTTCTGGG + Intergenic
937697619 2:124825672-124825694 TTTGATCAGCAGCCCCTTCCAGG - Intronic
938310359 2:130285279-130285301 TCAGACCATCAGCACCAGCTGGG - Intergenic
938444575 2:131367090-131367112 TCAGACCATCAGCACCAGCTGGG + Intergenic
940089151 2:149896740-149896762 TGTGCTCAGCAGCAGCACCTGGG + Intergenic
941484842 2:166067264-166067286 TTTTATCAACATCACCATCTTGG - Intronic
941484947 2:166068306-166068328 ATTGATCAACATCACCATCTTGG + Intronic
943125615 2:183791759-183791781 TCTGCCCAGCTGCCCCATCTGGG - Intergenic
943125650 2:183791911-183791933 TCTGCCCAGCTGCCCCATCTGGG - Intergenic
943125726 2:183792174-183792196 TCTGCCCAGCTGCCCCATCTGGG - Intergenic
943125788 2:183792402-183792424 TCTGCCCAGCTGCCCCATCTGGG - Intergenic
943418584 2:187637653-187637675 TCTGCCCAGCCGCCCCATCTGGG - Intergenic
946320514 2:218951442-218951464 TCTGCCCAGCAGAACCACCTGGG - Intergenic
947531348 2:230910524-230910546 TGGGATCTGCTGCACCATCTGGG - Exonic
948230901 2:236348725-236348747 TCTGCTCTTCAGCATCATCTGGG - Intronic
948382730 2:237562065-237562087 TCTAATCAGCAGCCCAAGCTGGG + Intergenic
1169125503 20:3124608-3124630 TCTGCCCAGCTGCCCCATCTGGG + Intronic
1170303347 20:14910538-14910560 TCTAACCAGCAGCCCCTTCTCGG - Intronic
1170633283 20:18083355-18083377 CCTGATCAGCAGGACCTTGTGGG - Intergenic
1173441054 20:43076705-43076727 TGTGGGCAGCAGCACCATCATGG - Intronic
1173790992 20:45827589-45827611 TCTGATCATCCTTACCATCTTGG - Intronic
1174728427 20:52889570-52889592 TCTGAGCAGCAGCAGCATGGGGG + Intergenic
1175801123 20:61801552-61801574 TCTGACCTCCAGCACCATGTGGG - Intronic
1176797149 21:13379293-13379315 TCTGCCCAGCCGCCCCATCTGGG + Intergenic
1176797172 21:13379367-13379389 TCTGCCCAGCCGCCCCATCTGGG + Intergenic
1176797194 21:13379441-13379463 TCTGCCCAGCCGCCCCATCTGGG + Intergenic
1176797251 21:13379626-13379648 TCTGCCCAGCCGCCCCATCTGGG + Intergenic
1176797566 21:13380877-13380899 TCTGCCCAGCTGCCCCATCTGGG + Intergenic
1176797612 21:13381069-13381091 TCTGCCCAGCTGCCCCATCTGGG + Intergenic
1176852687 21:13935104-13935126 TCTGCCCAGCCGCACCATCTGGG - Intergenic
1176852791 21:13935441-13935463 TCTGCCCAGCCGCCCCATCTGGG - Intergenic
1176852869 21:13935744-13935766 TCTGCCCAGCCGCGCCATCTGGG - Intergenic
1178113394 21:29392728-29392750 TCTGCCCAGCCGCCCCATCTGGG - Intronic
1178958769 21:37045290-37045312 TCCTATCAGCAGCAGCAGCTGGG + Intergenic
1179957474 21:44749586-44749608 TCTGTTCACCAGCTCCATGTCGG + Intergenic
1180967044 22:19795804-19795826 TCTGAGCAGCAGCAGCTGCTGGG - Intronic
1182855425 22:33513059-33513081 TCTCACCAGCAAAACCATCTGGG - Intronic
949396505 3:3620045-3620067 CATCATCAGCAGCATCATCTAGG + Intergenic
950057593 3:10039731-10039753 ACTGATCAGCTGCATGATCTTGG - Exonic
950901618 3:16503234-16503256 TCAGACCAGCAGCAGCATCCAGG + Intronic
951960691 3:28315857-28315879 TCTACTCAGCTGTACCATCTAGG + Intronic
952754590 3:36855366-36855388 TTTCATCAGCAGCGCCAGCTCGG + Exonic
953307221 3:41841559-41841581 TCTGCCCGGCAGCCCCATCTGGG + Intronic
957482500 3:80816454-80816476 TCTCAGCAGCAGCACCAGCACGG - Intergenic
958047558 3:88303739-88303761 TCTGCCCAGCCGCCCCATCTGGG + Intergenic
958406747 3:93762975-93762997 TCTGCCCAGCTGCCCCATCTGGG - Intergenic
958407135 3:93764330-93764352 TCTGCCCAGCCGCCCCATCTGGG - Intergenic
958737261 3:98023889-98023911 TCAGACCAGCAGCATCACCTAGG + Intronic
959797996 3:110456210-110456232 TATTATTATCAGCACCATCTAGG - Intergenic
960918821 3:122725288-122725310 TCTGCCCAGCTGCCCCATCTGGG - Intronic
962633472 3:137303596-137303618 TCAGATCATCAGCTCCATCTTGG + Intergenic
964485113 3:157178770-157178792 TCTGCCCAGCCGCCCCATCTAGG - Intergenic
966535468 3:181028267-181028289 GCTGATCATCAGCATCACCTGGG + Intergenic
967120159 3:186375544-186375566 TCACATCTGCAACACCATCTGGG - Intergenic
970251516 4:14121131-14121153 TCAGATCAGCAGAGCCATCCAGG + Intergenic
971163344 4:24156914-24156936 TTTGGTCAGCAACACCATTTGGG - Intergenic
972679940 4:41295643-41295665 CCAGATAAGCAGCACCCTCTAGG - Intergenic
972700630 4:41491115-41491137 TCTGCCCAGCCGCCCCATCTGGG - Intronic
973021232 4:45207735-45207757 TCTGCCCAGCCGCCCCATCTGGG + Intergenic
973021263 4:45207848-45207870 TCTGCTCGGCCGCCCCATCTGGG + Intergenic
973021307 4:45208002-45208024 TCTGCTCGGCCGCCCCATCTGGG + Intergenic
973021510 4:45208757-45208779 TCTGCCCGGCAGCCCCATCTGGG + Intergenic
973239183 4:47939121-47939143 TCTGGTGACCAGCCCCATCTTGG - Intronic
977331943 4:95647401-95647423 TTTGGTAAGCAGCAGCATCTAGG - Intergenic
978156991 4:105500684-105500706 TCTGCCCGGCAGCCCCATCTTGG - Intergenic
978476060 4:109131779-109131801 ACTGTTCAGGGGCACCATCTGGG - Intronic
979941842 4:126771514-126771536 TCTGCCCAGCAGCCCCGTCTGGG + Intergenic
981471317 4:145138506-145138528 TCTGAGCAGCAGGAGCCTCTTGG + Exonic
981572570 4:146168430-146168452 TTTGTTCAGCAGCCACATCTAGG + Intergenic
981994949 4:150964256-150964278 TCTGCCCAGCAGCCCCGTCTGGG + Intronic
986181777 5:5399804-5399826 ACTGACCAGCACCATCATCTGGG - Intergenic
987085059 5:14460430-14460452 TCTGACCAGCAGCAGCCTCTGGG - Intronic
987708681 5:21483960-21483982 TCTGATCAGCAGGATTTTCTTGG + Intergenic
989071912 5:37519714-37519736 TCTGCCCAGCCGCCCCATCTGGG - Intronic
989663481 5:43824643-43824665 TCTGACCAGCCACCCCATCTGGG - Intergenic
989991793 5:50774915-50774937 TCTGCCCAGCCGCCCCATCTGGG - Intronic
990525109 5:56617751-56617773 TCTGGTCAACAGCCTCATCTGGG + Intergenic
990709288 5:58563904-58563926 TCTGCCCAGCCGCCCCATCTGGG - Intergenic
991917078 5:71615898-71615920 TCTGGTGACCAGCACCATCCAGG - Intronic
992293551 5:75304899-75304921 TGAGAGCAGCACCACCATCTTGG + Intergenic
992489817 5:77231658-77231680 TCTCTTCATCAGAACCATCTGGG - Intronic
994118466 5:96087845-96087867 TCTGATCTGAAGCAGCATCTGGG - Intergenic
994486303 5:100389328-100389350 TCTGATCATCAGCATTTTCTTGG - Intergenic
994603542 5:101938670-101938692 TCTGTACAACAACACCATCTAGG - Intergenic
995088443 5:108142810-108142832 TCAGATCAGCAGCAGCAGCAGGG + Intronic
995404691 5:111781382-111781404 TCTGACCAGCAGCCCCAGATGGG + Intronic
999798327 5:155008971-155008993 TCTCAAGACCAGCACCATCTAGG - Intergenic
1000338509 5:160259662-160259684 TGTGCTCAGCAGCTCCTTCTTGG + Exonic
1001233225 5:170007926-170007948 CCAGATCAGCAGCAGCACCTGGG - Intronic
1002003623 5:176214549-176214571 TCTGCCCAGCCGCCCCATCTGGG + Intergenic
1002472104 5:179441594-179441616 TCCCATCAGCAGCTCCATATGGG + Intergenic
1003774075 6:9339841-9339863 CCAGACCAGCAGCATCATCTGGG - Intergenic
1004650110 6:17600385-17600407 TCGCCTCAGCAGCACCCTCTGGG - Exonic
1005242567 6:23848955-23848977 TCAGATCGGCAGCAACATTTAGG + Intergenic
1005370135 6:25123710-25123732 ACGGAGCAGCAGCACTATCTGGG + Intergenic
1006783699 6:36650424-36650446 TCTGACCAGAAGCAGCAACTGGG + Intergenic
1008572052 6:52825623-52825645 TCTGCCCAGCCGCCCCATCTGGG + Intergenic
1009869148 6:69433229-69433251 TCTGCTCGGCTGCCCCATCTGGG - Intergenic
1010400638 6:75442108-75442130 TCTGCTCCGCCGCCCCATCTGGG - Intronic
1011668449 6:89658720-89658742 GCTGAGCAGCATCTCCATCTTGG + Exonic
1015243880 6:131055750-131055772 TCTTTTTTGCAGCACCATCTTGG - Intronic
1015936730 6:138412160-138412182 TCTGATCAGCAGCACCGGCATGG + Intronic
1017636527 6:156449413-156449435 TCTGAGCAGAAGCACCTTCCTGG + Intergenic
1017855608 6:158348713-158348735 TCTGCCCAGCCGCCCCATCTGGG - Intronic
1017855619 6:158348750-158348772 TCTGCCCAGCTGCCCCATCTGGG - Intronic
1017855724 6:158349126-158349148 TCTGCCCAGCTGCCCCATCTGGG - Intronic
1019577567 7:1744764-1744786 GCAGATCAACAGCACCATCGTGG + Exonic
1019671864 7:2284254-2284276 CCTGACCAGAAGCAGCATCTGGG - Intronic
1020152525 7:5694396-5694418 TCTGACCACGAGCACTATCTGGG + Intronic
1022318265 7:29264245-29264267 TCTGCCCAGCAGCCCCGTCTGGG + Intronic
1023185962 7:37533224-37533246 TCTAGCCAGCAGCACCCTCTGGG - Intergenic
1023600109 7:41874387-41874409 GCTGATCTGCAGCCCCATTTGGG + Intergenic
1023732919 7:43209286-43209308 TCTGATCAGCAGGAGCAACAGGG - Intronic
1023954125 7:44871475-44871497 TCTGCCCCGCCGCACCATCTGGG - Intergenic
1024385381 7:48745568-48745590 TCTGCTCATCTGTACCATCTTGG - Intergenic
1024910646 7:54443968-54443990 TCTGCCCAGCCGCCCCATCTGGG + Intergenic
1025951470 7:66148742-66148764 CCTGAACAGCACTACCATCTAGG + Intronic
1026186010 7:68082809-68082831 TCTGCCCAGCCGCCCCATCTAGG + Intergenic
1026783488 7:73284678-73284700 TCTGCTCCGCCGCCCCATCTGGG - Intergenic
1028535760 7:91888092-91888114 TCTGCCCAGCCGCCCCATCTGGG + Intergenic
1028535883 7:91888550-91888572 TCTGCCCAGCCGCCCCATCTGGG + Intergenic
1029001618 7:97160321-97160343 TCTGCCCAGCCGCCCCATCTGGG + Intronic
1030173252 7:106626011-106626033 TCTGATCATCTCCACCCTCTTGG - Intergenic
1032363419 7:131276880-131276902 ACTGATCAGCAACCACATCTAGG - Intronic
1033185675 7:139225541-139225563 TCTGCCCAGCCGCCCCATCTGGG + Intergenic
1034463846 7:151214016-151214038 TCGGGTCAGGAGCTCCATCTGGG - Intronic
1034839910 7:154386257-154386279 ATTGACCAGGAGCACCATCTAGG + Intronic
1036615822 8:10386677-10386699 TGGGATCAGCAGCATCACCTGGG - Intronic
1038340813 8:26683735-26683757 TCTGCCCAGCTGCCCCATCTGGG - Intergenic
1041600672 8:59713605-59713627 TCTGATCAGCACCACCAAGAAGG - Intergenic
1044436552 8:92171021-92171043 ACTGATGAGCTGCCCCATCTGGG - Intergenic
1044581867 8:93833310-93833332 TCTGCCCAGCCGCCCCATCTGGG - Intergenic
1044582265 8:93834621-93834643 TCTGCCCAGCTGCCCCATCTGGG - Intergenic
1048357414 8:133664821-133664843 TCAGAACAGCAGCAACATCCCGG - Intergenic
1049563536 8:143325384-143325406 TCTCTTCAGCATCCCCATCTTGG + Exonic
1049709148 8:144055929-144055951 TCTGCTCCCCAGCACCATCCTGG - Exonic
1049873005 8:144995620-144995642 TCCTACCAGCAGCACCATCAAGG + Intergenic
1050420000 9:5453422-5453444 TTTGATCAGCAACACTATTTGGG + Intronic
1055154787 9:73048073-73048095 TCTGTTCTGCAGCTGCATCTGGG + Intronic
1055718530 9:79145547-79145569 TATCATCAGCGGGACCATCTGGG - Intergenic
1058431127 9:104920560-104920582 TCTGTGCAGTGGCACCATCTCGG + Intronic
1060641250 9:125241085-125241107 GCTGAGCAGCAGCAGCATCGCGG + Exonic
1060894038 9:127206173-127206195 GCTGATCAGTAGCATCACCTGGG + Intronic
1061261700 9:129483803-129483825 TCTGCTCAGCAGCTTCGTCTGGG - Intergenic
1061324806 9:129857381-129857403 TGTGATCAGCAGGGCCTTCTGGG - Intronic
1061326586 9:129868234-129868256 TGGGATCAGCAGCTCCGTCTCGG - Exonic
1185619879 X:1447327-1447349 TTGGATAAGCACCACCATCTTGG + Intronic
1185619891 X:1447419-1447441 TTGGATAAGCACCACCATCTTGG + Intronic
1185619914 X:1447565-1447587 TTGGATAAGCACCACCATCTTGG + Intronic
1185619922 X:1447619-1447641 TTGGATAAGCACCACCATCTTGG + Intronic
1185619945 X:1447784-1447806 TTGGATAAGCACCACCATCTTGG + Intronic
1185619989 X:1448096-1448118 TTGGATAAGCACCACCATCTTGG + Intronic
1185619997 X:1448150-1448172 TTGGATAAGCACCACCATCTTGG + Intronic
1185620003 X:1448188-1448210 TTGGATAAGCACCACCATCTTGG + Intronic
1185620010 X:1448242-1448264 TTGGATAAGCACCACCATCTTGG + Intronic
1185620017 X:1448296-1448318 TTGGATAAGCACCACCATCTTGG + Intronic
1185620047 X:1448495-1448517 TTGGATAAGCACCACCATCTTGG + Intronic
1185620055 X:1448552-1448574 TTGGATAAGCACCACCATCTTGG + Intronic
1185620063 X:1448606-1448628 TTGGATAAGCACCACCATCTTGG + Intronic
1185620069 X:1448644-1448666 TTGGATAAGCACCACCATCTTGG + Intronic
1185620085 X:1448752-1448774 TTGGATAAGCACCACCATCTTGG + Intronic
1185620091 X:1448790-1448812 TTGGATAAGCACCACCATCTTGG + Intronic
1189108081 X:38256882-38256904 TCTGATCAGTCCCACCATCTCGG + Intronic
1189723961 X:43950009-43950031 CCTGGCCAGGAGCACCATCTGGG + Exonic
1190820287 X:53966950-53966972 TCTGCCCAGCCGCCCCATCTGGG + Intronic
1192349911 X:70348927-70348949 TCTGCCCAGCTGCCCCATCTGGG - Intronic
1192658960 X:73022105-73022127 TCTGCCCAGCTGCCCCATCTGGG - Intergenic
1192885739 X:75334956-75334978 TCTGACCAGTAGCCCCGTCTGGG - Intergenic
1192885749 X:75334993-75335015 TCTGCCCAGCCGCCCCATCTGGG - Intergenic
1192901660 X:75505376-75505398 TCTGCTCCTCACCACCATCTTGG - Intronic
1193535314 X:82708223-82708245 TCTGATCTGTATCCCCATCTTGG - Intergenic
1194897531 X:99463336-99463358 TCTGATCTGCAACAGCAGCTGGG + Intergenic
1198167096 X:134068793-134068815 TCAGAACAGCAGCTGCATCTAGG + Intergenic
1198600731 X:138282610-138282632 TCTGCCCAGCGGCCCCATCTGGG - Intergenic
1198730392 X:139721816-139721838 TCTGCTGAGCAGCACCTTCAGGG - Intergenic
1199173729 X:144759792-144759814 TATGAGCATCAGCATCATCTAGG + Intergenic
1200757858 Y:7008025-7008047 TCTGAGAAGCAGCATGATCTTGG - Intronic
1201294784 Y:12453744-12453766 TCTGCCCAGCCGCCCCATCTGGG - Intergenic
1202028978 Y:20552488-20552510 TCTGCCCAGCTGCCCCATCTGGG + Intergenic