ID: 1070129344

View in Genome Browser
Species Human (GRCh38)
Location 10:73646267-73646289
Sequence GGGTGGCTTAGTGCAAACAG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 100}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070129331_1070129344 11 Left 1070129331 10:73646233-73646255 CCAGTCAAGCTTGGGAAAGCAGA 0: 1
1: 0
2: 1
3: 10
4: 140
Right 1070129344 10:73646267-73646289 GGGTGGCTTAGTGCAAACAGGGG 0: 1
1: 0
2: 1
3: 8
4: 100
1070129328_1070129344 23 Left 1070129328 10:73646221-73646243 CCTAGGTATATGCCAGTCAAGCT 0: 1
1: 0
2: 2
3: 9
4: 98
Right 1070129344 10:73646267-73646289 GGGTGGCTTAGTGCAAACAGGGG 0: 1
1: 0
2: 1
3: 8
4: 100

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070129344 Original CRISPR GGGTGGCTTAGTGCAAACAG GGG Exonic
902153404 1:14463105-14463127 GGGTGGGTTAATGCAAATTGAGG + Intergenic
902260117 1:15218834-15218856 GGGTGGGTTAATGCAAATTGAGG - Intronic
905486034 1:38297414-38297436 CAGTGGCTTAATGCAATCAGAGG - Intergenic
905764939 1:40592499-40592521 GGGTGGGTTAATGCAAATTGAGG - Intergenic
908319548 1:62966736-62966758 GTGTGGCCTCGTGCAAAGAGGGG + Intergenic
914959470 1:152193651-152193673 GGGTCCCTTAGTCCAAACTGGGG + Intergenic
916605654 1:166339937-166339959 GGGTGGCTTAGTGCAGGGGGAGG + Intergenic
919769214 1:201146592-201146614 GGCTGGCCTAGTGCAGACACTGG - Intronic
922215175 1:223514529-223514551 GGATGGCAGAGTGCAAAGAGGGG - Intergenic
1067488252 10:46672975-46672997 GGGAGGCTTAATGAAAACAGAGG + Intergenic
1067606549 10:47669053-47669075 GGGAGGCTTAATGAAAACAGAGG - Intergenic
1070129344 10:73646267-73646289 GGGTGGCTTAGTGCAAACAGGGG + Exonic
1070742006 10:78909383-78909405 AGGTGGCTTAGAGCCAAGAGGGG - Intergenic
1074813537 10:117127443-117127465 GGATGGCTGAGTGCAAGTAGTGG - Intergenic
1075518537 10:123129404-123129426 TGGTGGTTTAGTGTAATCAGTGG - Intergenic
1076200558 10:128554441-128554463 GGGTGGGTTAATGTAAACTGAGG + Intergenic
1076203432 10:128576373-128576395 GGGTGGCTGAGAGCGAGCAGGGG - Intergenic
1077983112 11:7321762-7321784 GGGCGGGTTAATGCAAATAGAGG + Intronic
1079246979 11:18759890-18759912 GGGGAGCTTTGTGAAAACAGGGG + Intronic
1080785773 11:35473738-35473760 GGGTGGCTAAATGGACACAGAGG - Intronic
1080792621 11:35535435-35535457 GGGTGGCTGATGACAAACAGTGG - Intergenic
1089034775 11:115376486-115376508 GTATGGCATAGTGCAAACAGAGG + Intronic
1089325166 11:117652000-117652022 TGCTGGCTTAGAGGAAACAGTGG - Intronic
1091757212 12:3061846-3061868 GGGTGGCTTAGTGACAGTAGAGG - Intergenic
1092764069 12:11836801-11836823 GGGTGGCTTATTGGAAACATGGG - Intronic
1096017051 12:48286133-48286155 GGGTGGTTTAATGCAAATTGAGG + Intergenic
1096614612 12:52824729-52824751 GGGTGCCTTTGTGCAAATTGGGG + Intronic
1105796262 13:23856509-23856531 GGGTGGGTTAATGCAAATTGGGG + Intronic
1105833091 13:24182948-24182970 GGGTGGCTTAGTGCATTCAGGGG + Intronic
1105915172 13:24908507-24908529 GGGAGGCTGAGAGCAAGCAGAGG + Intronic
1112751485 13:102588329-102588351 GGGTGGGTTAATGCAAACTGAGG + Intergenic
1114165850 14:20217467-20217489 GGGTGGCTTGCTGCCCACAGAGG + Intergenic
1116770270 14:49119359-49119381 GAGTGGCTTATTGCCCACAGAGG - Intergenic
1118696064 14:68386439-68386461 GGGTGCCTTACAGCAAAGAGAGG - Intronic
1124900388 15:33817257-33817279 GGGTGGCCTCCTGCAACCAGTGG - Intronic
1126208040 15:46068722-46068744 GGGTGGCTCATTGGAAACACAGG + Intergenic
1132699096 16:1214696-1214718 GGGTGGCTTCCTGGAGACAGTGG + Intronic
1133085992 16:3364084-3364106 AGGTTGCTTTGTGCAACCAGAGG + Intergenic
1135329607 16:21550278-21550300 GGGGGGCTCAGAGCACACAGTGG - Intergenic
1136339944 16:29636233-29636255 GGGGGGCTCAGAGCACACAGTGG - Intergenic
1141228108 16:82138581-82138603 GGGTTGCTTACTGTAAATAGGGG - Intergenic
1141828501 16:86497024-86497046 AGGGGGCTGATTGCAAACAGAGG + Intergenic
1141986810 16:87585542-87585564 GGCTGGCTTCCTGCAAACCGGGG + Intergenic
1142042619 16:87904809-87904831 GGGGGGCTCAGAGCACACAGTGG - Exonic
1142158017 16:88541555-88541577 GGGTGGGTTAATGCAAATTGAGG + Intergenic
1144660164 17:17062953-17062975 TGGTGGCATAGTGCACACAGTGG + Intronic
1146729727 17:35183175-35183197 TGGAGGCTGAATGCAAACAGAGG + Intronic
1148456819 17:47815619-47815641 GAATGGGTTAGTGCACACAGAGG - Intronic
1150511181 17:65754671-65754693 GGTTGGATCAGTGCAACCAGTGG + Intronic
1152843445 17:82585086-82585108 TGGGGGCTTAGAGCAAAGAGAGG - Intronic
1160342667 18:78102663-78102685 AGCTGGGTTTGTGCAAACAGCGG + Intergenic
1162501328 19:11055649-11055671 GGGGGGCTTACTGCACACTGTGG - Intronic
1163454306 19:17397271-17397293 GGGTGGCTCGGTGCTCACAGTGG - Intergenic
926738427 2:16091547-16091569 GTGTGGCTGAGTGCAGAGAGCGG + Intergenic
927654389 2:24933116-24933138 GGGAGGCTTAGTGAAGCCAGAGG - Intergenic
930383947 2:50668607-50668629 GAGTAGCTTAGTACAACCAGCGG + Intronic
930610657 2:53539382-53539404 AGATGGCATAGTGCAACCAGTGG - Intronic
931954955 2:67412638-67412660 GGGTTGCTTACTGCAGACAGTGG + Intergenic
938219405 2:129552670-129552692 GAGTGGCTTAGTGGGAAGAGTGG - Intergenic
939888043 2:147702736-147702758 GGGTGGCTTAGAGTAGAGAGAGG + Intergenic
940370442 2:152895470-152895492 GTATGTCTTAGTGGAAACAGTGG - Intergenic
942217955 2:173740814-173740836 TGTTGGCTTAATGCCAACAGTGG - Intergenic
943780097 2:191813907-191813929 GGGTGTCTTGTTCCAAACAGAGG + Intergenic
946967164 2:225048606-225048628 TTGGGGCATAGTGCAAACAGAGG + Intergenic
948547393 2:238742611-238742633 GGGTGGCTTATTACAAAGGGTGG - Intergenic
1171900403 20:30851084-30851106 GGGTGGCATCCTGCAACCAGGGG + Intergenic
1173088463 20:39947592-39947614 GGGTGGGAAAGTGCAGACAGTGG + Intergenic
1178884769 21:36476373-36476395 GGGAGGCTCAGTGCCCACAGTGG - Intronic
1181014616 22:20061917-20061939 GGGAGGCTCAGTGCACCCAGAGG + Intronic
1184452406 22:44590948-44590970 GGGTGCTTTAGTGCAATCAAGGG + Intergenic
952193487 3:31047847-31047869 CAGTGCCTCAGTGCAAACAGGGG + Intergenic
957361933 3:79172126-79172148 GGGAGGCTTAGAGCAAATTGAGG - Intronic
958969187 3:100592383-100592405 GGGTGACTGAGTGAAAACTGTGG + Intergenic
958996447 3:100910812-100910834 CTGTGGATTACTGCAAACAGGGG + Intronic
960674435 3:120180891-120180913 GTGTGGAAGAGTGCAAACAGGGG + Intronic
961429188 3:126868321-126868343 GTGTTGCTTGGTGCCAACAGGGG + Intronic
965843305 3:172931976-172931998 GTTTGGCTTAGTGCAACCAATGG + Intronic
968137422 3:196229026-196229048 GGGTGGCTGTGGGAAAACAGAGG + Intronic
976075947 4:81298973-81298995 GAGTGAGTGAGTGCAAACAGGGG - Intergenic
979336566 4:119470214-119470236 GGGTGACTCATTGCAAGCAGGGG + Intergenic
983239468 4:165215556-165215578 GGGTGACTCATTGCAAGCAGGGG + Intronic
984958132 4:185066272-185066294 GGGTGGCTAAATGCAATCTGTGG + Intergenic
985316722 4:188665921-188665943 GGGAAGCTTAGTGCATACGGTGG - Intergenic
986153074 5:5145747-5145769 GGATGGCTTGTTCCAAACAGTGG - Intronic
989096593 5:37787588-37787610 TGCTGGCTTAGTGCATTCAGAGG + Intergenic
996996930 5:129708078-129708100 GGGTGGTTTTGTGTAAATAGTGG + Intronic
997056437 5:130450164-130450186 GGATGGAGTAGTGCAAGCAGTGG - Intergenic
1001341843 5:170854371-170854393 GTGTGGATCAGTGGAAACAGCGG + Intergenic
1002336990 5:178486600-178486622 GGGTGGTTTTGTGAAAGCAGAGG + Intronic
1008001372 6:46364096-46364118 GGGTGTCTTAGTGAACACTGGGG - Intronic
1010675913 6:78742752-78742774 GGGTGGGTTAATGCAAATTGAGG - Intergenic
1017582745 6:155884366-155884388 GGGAGTCAGAGTGCAAACAGTGG - Intergenic
1019056008 6:169224011-169224033 GGTGGGCCTGGTGCAAACAGGGG + Intronic
1024747671 7:52427161-52427183 GGGTGGGTTAATGCAAATTGAGG - Intergenic
1028479245 7:91286647-91286669 AGGTGGCCCAGTGCCAACAGGGG + Intergenic
1034141221 7:148819054-148819076 GAGTGGCTTGGTTCAAAGAGGGG + Intronic
1035727231 8:1832087-1832109 GGGTGGTTTAGTCCACCCAGGGG + Intronic
1041586969 8:59532110-59532132 GGGTGATTTAGTTCAAACAAGGG + Intergenic
1042166657 8:65952043-65952065 TGGTGGCTTAGTACAAAGATAGG - Intergenic
1045167959 8:99628167-99628189 GTGTGACTTAGTGGAAACTGTGG + Intronic
1051906416 9:22099918-22099940 GGGTGGCTGAGGGAGAACAGCGG + Intergenic
1052434041 9:28403249-28403271 GGTTGGAGTAGTGCAAAGAGAGG + Intronic
1055750704 9:79501790-79501812 GGGTGGCTGATTACAAATAGAGG + Intergenic
1057341935 9:94210724-94210746 GGGAGGCTTAGTGGAAAATGGGG - Intergenic
1190003435 X:46711440-46711462 TTGTGGCTTAGTGTAAAGAGAGG + Intronic
1190936572 X:55003480-55003502 GGGTGGGTTAGAGCAATCAAGGG + Intronic
1190992303 X:55565202-55565224 GGGTGGCTTACTGATATCAGAGG + Intergenic
1192365796 X:70472075-70472097 AGATGGCAGAGTGCAAACAGGGG - Intronic
1195373931 X:104207065-104207087 GGGTGGGTTAATGCAAATTGAGG + Intergenic
1197765740 X:130058473-130058495 GGGTGGCCTAGGGCAAGCAGGGG - Intergenic