ID: 1070130033

View in Genome Browser
Species Human (GRCh38)
Location 10:73649315-73649337
Sequence CCTAACATGGTCCCTATGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 72
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 65}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070130033_1070130038 -2 Left 1070130033 10:73649315-73649337 CCCATCATAGGGACCATGTTAGG 0: 1
1: 0
2: 0
3: 6
4: 65
Right 1070130038 10:73649336-73649358 GGAGGCTTCTCATGAAGCTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070130033 Original CRISPR CCTAACATGGTCCCTATGAT GGG (reversed) Intronic
905094983 1:35462491-35462513 CCTAACATGGTCAAGATGACTGG + Intronic
912425674 1:109587723-109587745 CCTACCATGATCCATATCATGGG + Intronic
914946666 1:152072971-152072993 CTTAAAATGGTGCCTAGGATGGG + Intergenic
916369784 1:164079442-164079464 TTTGACATGGTCCCTATAATTGG - Intergenic
916878981 1:169000469-169000491 CCTAACATGGTCCCTAGACATGG - Intergenic
921972022 1:221160213-221160235 CCCAATATGGTGCCTATAATTGG - Intergenic
922866820 1:228867604-228867626 CATAACATGGACCATATAATTGG - Intergenic
923310383 1:232729255-232729277 CCTAAGATGGTCAATATGGTGGG + Intergenic
1068825177 10:61429327-61429349 GCTAATATGGTCCTTAAGATGGG + Intronic
1070130033 10:73649315-73649337 CCTAACATGGTCCCTATGATGGG - Intronic
1082843065 11:57704998-57705020 GCCAGCATGGTCCCTGTGATAGG + Exonic
1084444827 11:69197395-69197417 CCTAACATGCTCCCTTGGCTAGG - Intergenic
1087546483 11:99590785-99590807 CCTAGCATGGTCAAGATGATTGG - Intronic
1094265246 12:28551235-28551257 CAGAACAATGTCCCTATGATTGG + Intronic
1102524592 12:113502974-113502996 CCCAAAAGAGTCCCTATGATAGG + Intergenic
1104000475 12:124856865-124856887 CCTCACTTGGTGCCTTTGATTGG + Intronic
1111793626 13:92889994-92890016 TCTAACAGGGTCCCTATCACAGG + Intergenic
1112630801 13:101159428-101159450 ACTAACATGTTGCCTATGCTGGG + Intronic
1121238311 14:92409628-92409650 CCTAACATGCTCCCCAGGATAGG + Intronic
1202888532 14_KI270722v1_random:132455-132477 CCTATCCAGGCCCCTATGATGGG - Intergenic
1125525358 15:40370696-40370718 CCTGACAAGATCCCTAGGATGGG - Exonic
1127178629 15:56389909-56389931 CCCAAGATGCTCCCTAGGATAGG + Intronic
1128290021 15:66471192-66471214 CATAACATGGCCCCTGTGAAAGG - Intronic
1129444529 15:75607656-75607678 CATAACACAGTGCCTATGATAGG - Intronic
1129885224 15:79032505-79032527 TCTAATGTGGTCCCAATGATGGG - Intronic
1129946478 15:79543123-79543145 CCTGCCATTCTCCCTATGATTGG - Intergenic
1137863384 16:51868971-51868993 GCTAACATGGTACTTATTATGGG + Intergenic
1138158420 16:54728742-54728764 CCTACTATGGTCCCTATGGTGGG + Intergenic
1145852606 17:28116177-28116199 GCTAACATGGTTTCTATCATTGG + Intronic
1145970859 17:28955731-28955753 CCTGACATGGGCCCAATGAAGGG + Exonic
1152356855 17:79811692-79811714 CCTAACCTGGTCCCTACCAGAGG + Intergenic
1156444470 18:37225002-37225024 CCAAACCTGATCCCCATGATGGG + Exonic
1157978599 18:52354242-52354264 CCTAATTTGGTACCTATGATGGG + Intronic
1161692038 19:5741430-5741452 CCCAAGATGGTGCCTATGTTGGG + Intronic
1164761152 19:30729298-30729320 CCTAACGTGGTCACTCTGTTTGG - Intergenic
935931049 2:108126056-108126078 CCTCATATTGACCCTATGATAGG + Intergenic
946802090 2:223429048-223429070 TCTAAGGTGGTCCATATGATAGG - Intergenic
1170941445 20:20851556-20851578 CCTAACATATTTCCTATGTTAGG + Intergenic
1176857371 21:13983898-13983920 CATAACATGGTCCCCACCATGGG - Intergenic
1177421799 21:20869130-20869152 CCTAAGCTAGTCCCTTTGATTGG - Intergenic
1180330657 22:11476132-11476154 CCTATCCAGGCCCCTATGATGGG - Intergenic
1180798770 22:18621555-18621577 GCTAACATGTTCCATTTGATAGG - Intergenic
1181222946 22:21373707-21373729 GCTAACATGTTCCATTTGATAGG + Intergenic
1183014039 22:34971369-34971391 CCTAACAAGCTCCCTGTGAGAGG + Intergenic
951178431 3:19629716-19629738 ACTAACATCGTGCCTATGTTGGG - Intergenic
955746614 3:62147022-62147044 GCTAACATGGTCTCTTTGACAGG - Intronic
956754185 3:72368989-72369011 CCCAATGTGGTCCCTATGGTGGG + Intergenic
957092027 3:75740368-75740390 CCTATCCAGGCCCCTATGATGGG + Intronic
957888436 3:86322945-86322967 CATATCTTGTTCCCTATGATAGG + Intergenic
960074531 3:113469761-113469783 CCTACCTTGGTCCCTAACATAGG + Intronic
972632466 4:40854192-40854214 CCTAACATAGTACCTAGTATAGG - Intronic
976410370 4:84706565-84706587 TATAACATGGTACCTATGTTGGG - Intronic
984068201 4:175076892-175076914 CCTATCAAGGTCCCTATCAAGGG + Intergenic
996260681 5:121463965-121463987 CCTCACATTGTATCTATGATAGG - Intergenic
999364023 5:151009676-151009698 CCTAACCTGGTCCCCAGGATAGG - Intergenic
1001736532 5:174008464-174008486 CCTAACACGGGCCCTGTAATGGG + Intergenic
1004605846 6:17194485-17194507 CATAACATGGGGCTTATGATTGG + Intergenic
1007281634 6:40716901-40716923 CATAACATAGTCTCTAAGATGGG + Intergenic
1019220976 6:170472544-170472566 CCTGAAATGGTCCCATTGATAGG + Intergenic
1022817917 7:33931088-33931110 CCTTACATGGTACCTCTCATAGG + Intronic
1023020221 7:36005239-36005261 CCTTACATCCTCCCTATGATAGG - Intergenic
1023507574 7:40916386-40916408 CCTAACATGGTCCACATCCTGGG - Intergenic
1027609667 7:80344938-80344960 CATAACATGGTTACTATGATTGG + Intergenic
1029565528 7:101334696-101334718 CCTAACATGTCCCGTATGAATGG - Intergenic
1040867784 8:52067992-52068014 CCTAAGATAGACCATATGATAGG - Intergenic
1053567424 9:39267893-39267915 CCCAGCATGGTGCCTATGAAGGG + Intronic
1053833440 9:42108843-42108865 CCCAGCATGGTGCCTATGAACGG + Intronic
1054129719 9:61351105-61351127 CCCAGCATGGTGCCTATGAAGGG - Intergenic
1054597109 9:67078568-67078590 CCCAGCATGGTGCCTATGAACGG - Intergenic
1062713829 9:137992665-137992687 TCTAAGATGGACCATATGATAGG + Intronic
1203485726 Un_GL000224v1:52375-52397 CCTATCCAGGCCCCTATGATGGG - Intergenic
1198472798 X:136964692-136964714 CCTCAGTAGGTCCCTATGATGGG - Intergenic