ID: 1070130231

View in Genome Browser
Species Human (GRCh38)
Location 10:73650874-73650896
Sequence ACCCCAGACTCTCATAGATA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070130224_1070130231 15 Left 1070130224 10:73650836-73650858 CCCTTCCTAAACTATTGACATCT 0: 1
1: 0
2: 0
3: 16
4: 205
Right 1070130231 10:73650874-73650896 ACCCCAGACTCTCATAGATATGG No data
1070130226_1070130231 10 Left 1070130226 10:73650841-73650863 CCTAAACTATTGACATCTTCCCC 0: 1
1: 0
2: 1
3: 15
4: 148
Right 1070130231 10:73650874-73650896 ACCCCAGACTCTCATAGATATGG No data
1070130225_1070130231 14 Left 1070130225 10:73650837-73650859 CCTTCCTAAACTATTGACATCTT 0: 1
1: 0
2: 0
3: 8
4: 181
Right 1070130231 10:73650874-73650896 ACCCCAGACTCTCATAGATATGG No data
1070130222_1070130231 26 Left 1070130222 10:73650825-73650847 CCCAAAGACTACCCTTCCTAAAC 0: 1
1: 0
2: 0
3: 13
4: 130
Right 1070130231 10:73650874-73650896 ACCCCAGACTCTCATAGATATGG No data
1070130228_1070130231 -10 Left 1070130228 10:73650861-73650883 CCCTCCATTCTAGACCCCAGACT 0: 1
1: 0
2: 0
3: 16
4: 192
Right 1070130231 10:73650874-73650896 ACCCCAGACTCTCATAGATATGG No data
1070130227_1070130231 -9 Left 1070130227 10:73650860-73650882 CCCCTCCATTCTAGACCCCAGAC 0: 1
1: 0
2: 0
3: 10
4: 237
Right 1070130231 10:73650874-73650896 ACCCCAGACTCTCATAGATATGG No data
1070130223_1070130231 25 Left 1070130223 10:73650826-73650848 CCAAAGACTACCCTTCCTAAACT 0: 1
1: 0
2: 0
3: 19
4: 175
Right 1070130231 10:73650874-73650896 ACCCCAGACTCTCATAGATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070130231 Original CRISPR ACCCCAGACTCTCATAGATA TGG Intronic
No off target data available for this crispr