ID: 1070133950

View in Genome Browser
Species Human (GRCh38)
Location 10:73675177-73675199
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 10, 1: 1, 2: 2, 3: 10, 4: 94}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070133950_1070133956 7 Left 1070133950 10:73675177-73675199 CCAAGTTCAAACTGGCCCACTTA 0: 10
1: 1
2: 2
3: 10
4: 94
Right 1070133956 10:73675207-73675229 GGGTCTCATAGTCCACACAGTGG 0: 1
1: 8
2: 2
3: 7
4: 104
1070133950_1070133957 8 Left 1070133950 10:73675177-73675199 CCAAGTTCAAACTGGCCCACTTA 0: 10
1: 1
2: 2
3: 10
4: 94
Right 1070133957 10:73675208-73675230 GGTCTCATAGTCCACACAGTGGG 0: 1
1: 8
2: 3
3: 9
4: 91
1070133950_1070133959 28 Left 1070133950 10:73675177-73675199 CCAAGTTCAAACTGGCCCACTTA 0: 10
1: 1
2: 2
3: 10
4: 94
Right 1070133959 10:73675228-73675250 GGGCGTTCCCACGCATGTTTTGG 0: 8
1: 2
2: 0
3: 2
4: 23

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070133950 Original CRISPR TAAGTGGGCCAGTTTGAACT TGG (reversed) Exonic
908421627 1:63964033-63964055 TAAGTGTCCCAGTTAGGACTAGG - Intronic
908940951 1:69432998-69433020 TAAGTGTGAGAGTTTGAAGTAGG - Intergenic
910184328 1:84520398-84520420 TAAGTTGGCCACTTGGCACTTGG - Intergenic
912342810 1:108934359-108934381 TAAGGAGGCCAGTTTGAATTGGG - Exonic
913102926 1:115585979-115586001 TAGGTGGGCCAGCTGGAAGTGGG + Intergenic
913252849 1:116926317-116926339 GATGTTGGCCAGTTTGAACGTGG + Intronic
913414592 1:118590816-118590838 TAAGTGGTATAGTTTGAACCCGG - Intergenic
915885750 1:159718901-159718923 TAAATGGTCCTGTTTGAAATGGG - Intergenic
917906118 1:179588495-179588517 TAACTGGGCCAGTTTGAACTTGG + Intergenic
919447882 1:197732282-197732304 TAGGTGGGCCAGTTAGGAATGGG - Intronic
919860244 1:201735134-201735156 TAGATGGGAGAGTTTGAACTGGG - Intronic
924808562 1:247381233-247381255 TAAGGGTGCCATTTTAAACTGGG + Intergenic
1065280179 10:24129082-24129104 GAAGTGGGCCATATTGAGCTAGG + Intronic
1067372652 10:45699631-45699653 TAAGTGGGCCAGTTTGAACTTGG + Intergenic
1067387126 10:45826493-45826515 TAAGTGGGCCAGTTTGAACTTGG - Exonic
1067419001 10:46130758-46130780 TAAGTGGGCCAGTTTGAACTTGG + Intergenic
1067447147 10:46358114-46358136 TAAGTGGGCCAGTTTGAACTTGG + Intergenic
1067504354 10:46837347-46837369 TAAGTGGGCCAGTTTGAACTTGG + Intergenic
1067590232 10:47502646-47502668 TAAGTGGGCCAGTTTGAACTTGG - Exonic
1067637352 10:48010748-48010770 TAAGTGGGCCAGTTTGAACTTGG - Intergenic
1067876135 10:50009586-50009608 TAAGTGGGCCAGTTTGAACTTGG + Exonic
1069299328 10:66886755-66886777 GAAATGGGCCAGTCTGAAATGGG - Intronic
1070133950 10:73675177-73675199 TAAGTGGGCCAGTTTGAACTTGG - Exonic
1071492539 10:86145632-86145654 TCAGAGGGGAAGTTTGAACTGGG - Intronic
1071607765 10:87009305-87009327 TAAGTGGGCCAGTTTGAACTTGG + Intergenic
1074058683 10:109944708-109944730 CACGTGGCCCAGTTTGAACTAGG + Intronic
1074608823 10:115001642-115001664 TAAGTGAGACAGTTTGCACCAGG - Intergenic
1075613638 10:123874810-123874832 TAAGTGGACCAGCATGTACTTGG + Intronic
1076608817 10:131707626-131707648 TAAGTGGGCATGTTTGGATTTGG - Intergenic
1076612206 10:131733445-131733467 TAAGTGGGCATGTTTGGATTTGG - Intergenic
1077401155 11:2358170-2358192 TAAGTGGGCCTGTCTGATGTGGG + Intergenic
1082860918 11:57855946-57855968 CAAGAGGTCAAGTTTGAACTGGG - Intergenic
1086539243 11:87887771-87887793 TATGTGGGACATTTTAAACTTGG + Intergenic
1090138513 11:124226760-124226782 TGAGTAGGAAAGTTTGAACTGGG - Intergenic
1091459466 12:632959-632981 TTAGTGGGCCGGGTTGAGCTTGG + Intronic
1091521701 12:1251629-1251651 AAAGTGGCCCAGTTTGAGATAGG - Intronic
1096881882 12:54679831-54679853 TTTGTGGAGCAGTTTGAACTTGG + Intergenic
1097262519 12:57727556-57727578 CACGTGGGCCAGCTTGAACCTGG - Exonic
1098779703 12:74671148-74671170 TAAATGGGCCAGTTCCAATTAGG - Intergenic
1099069692 12:78030371-78030393 TCTGTGGGCCAGTCTGAGCTAGG - Intronic
1103293904 12:119869958-119869980 CAAGTGGGCCAGTTGGAAGATGG - Intronic
1104183951 12:126410325-126410347 AAGGTGGGACAGTTTGAAGTGGG - Intergenic
1105466555 13:20647612-20647634 TAAGTGGACCAGTCAGAACTAGG - Intronic
1108244913 13:48504496-48504518 AACTTGGGGCAGTTTGAACTGGG - Intronic
1110101087 13:71603677-71603699 TATGTTGGCCAGTTTTAAATGGG + Intronic
1111884347 13:94000567-94000589 CAAGTTGGACAGTTGGAACTGGG + Intronic
1114847324 14:26338913-26338935 TAAGAGGGTCATTTTGAACAAGG - Intergenic
1120353711 14:83400396-83400418 TAAGTGGCACAGTTAAAACTGGG + Intergenic
1121227403 14:92331199-92331221 TCAGAGGGCTACTTTGAACTGGG - Intronic
1128125846 15:65192276-65192298 TGATTGGCCCAGTTTGAATTGGG - Intergenic
1131661438 15:94522066-94522088 TAAGTGGAGCATCTTGAACTTGG + Intergenic
1131991806 15:98100272-98100294 TTTGTGGGCCAGTTGGAATTTGG - Intergenic
1132272036 15:100534939-100534961 TAGGTGGGACAATTTGAAGTGGG - Intronic
1133890417 16:9874137-9874159 TGAGTGGGCCTGTTTGAGATGGG - Intronic
1138703503 16:58890360-58890382 TTAGTGGGACAGTTTAAAGTTGG - Intergenic
1143249151 17:5509842-5509864 AAAGTGGGCCACTTGGAACAGGG - Intronic
1143250809 17:5521746-5521768 AAAGTGGGCCATTTGGAACAGGG + Exonic
1144453026 17:15396951-15396973 ACACTGGGCCAGTTTGATCTAGG - Intergenic
1152937520 17:83148989-83149011 TAAGAGGGCCAGTCAGACCTGGG + Intergenic
1203167812 17_GL000205v2_random:114212-114234 TAAATAGGGCTGTTTGAACTGGG - Intergenic
1161757343 19:6143807-6143829 GAAGGGGGCCTGTATGAACTAGG + Intronic
1167692181 19:50992537-50992559 TAATTGGTCCAGTTTGAACTGGG - Intergenic
929676898 2:43943542-43943564 TAAGAGGGCTAATATGAACTAGG - Intronic
934674513 2:96240120-96240142 TAAGTGGGCCTGCTTGAAGTTGG + Intergenic
937465833 2:122132216-122132238 TTAGTCAGCCATTTTGAACTGGG + Intergenic
939902000 2:147861950-147861972 TATTTGAGCCTGTTTGAACTAGG + Intronic
941809325 2:169739467-169739489 TAAGTAGCCCAGTTTGACCAGGG - Intronic
943551445 2:189345256-189345278 CAATTGGGCCAGTTTCACCTTGG + Intergenic
944525382 2:200613654-200613676 ATGGTGGGCCAATTTGAACTCGG + Intronic
945743162 2:213688082-213688104 AAGGTGGGGCAGTTTGAACTTGG + Intronic
948189795 2:236049063-236049085 CAACTGGGCCAGTTTGAACTTGG + Exonic
1169419177 20:5445601-5445623 TAAGTGGGCCACCTTGGAATTGG - Intergenic
1176403945 21:6344924-6344946 TAAATAGGGCTGTTTGAACTGGG + Intergenic
1176433212 21:6644180-6644202 TAAATAGGGCTGTTTGAACTGGG - Intergenic
1177695909 21:24569957-24569979 TAAGTGGGGCACTATGTACTTGG - Intergenic
1181677471 22:24465545-24465567 TAGGAGGCCCAGATTGAACTGGG - Intergenic
1182309970 22:29397615-29397637 TAAGTGGGCATCTTGGAACTGGG + Intronic
956623576 3:71245365-71245387 GAGGAGGGCCTGTTTGAACTAGG - Intronic
958740341 3:98061722-98061744 AAATTGGGCCAGTTTGTTCTGGG + Intergenic
964384449 3:156132199-156132221 CAAGGGGTCCAGTTTGAACAAGG - Intronic
964780731 3:160334708-160334730 AAAGTGAGCCAATTTGAGCTGGG - Intronic
968048354 3:195636295-195636317 TGAGTGGGCCAGTGGGACCTGGG + Intergenic
968099049 3:195953325-195953347 TGAGTGGGCCAGTGGGACCTGGG - Intergenic
968306255 3:197653626-197653648 TGAGTGGGCCAGTGGGACCTGGG - Intergenic
968869706 4:3235472-3235494 CCAGTGGGCCAGTTTTGACTTGG + Intronic
969906497 4:10401476-10401498 TAACTGGGCCAGATTGATCAGGG + Intergenic
972089630 4:35265069-35265091 TAAGTGGGACATTTTCACCTTGG + Intergenic
975241731 4:72067225-72067247 AAAGTGGGCCAGGTAGAACTCGG - Intronic
976628543 4:87213141-87213163 TAAGTGGCCCAGTTCAAACAAGG - Intronic
976772354 4:88666936-88666958 TGAGTGGACCAGTTTGCACAGGG + Intronic
978160647 4:105543558-105543580 TAACTAGGTCAGTTTGCACTTGG - Intergenic
982800946 4:159706948-159706970 GAAGTAGGCCAATTTAAACTGGG - Intergenic
985504838 5:272774-272796 TGAGTGGGCCAGTGGGAACTGGG + Intronic
985743276 5:1632821-1632843 TGAGTGGGCCAGTGGGAACTGGG - Intergenic
986683325 5:10253028-10253050 TAAGAGGGCCAGTTTCAGCCGGG + Intronic
1000662448 5:163952315-163952337 GAAGTGGGCCATACTGAACTGGG + Intergenic
1004703366 6:18100007-18100029 AAAGTGGGCAAGTTAGACCTCGG + Intergenic
1005678879 6:28184748-28184770 AAACTGGGCCAATTTGAATTTGG - Intergenic
1007955392 6:45913570-45913592 AAAGTGGTCCAGGTTGAAGTGGG + Intronic
1012319029 6:97819566-97819588 AAATTGGGCCAGTTTAAAGTGGG + Intergenic
1015330054 6:131966915-131966937 TAAATGGGCCATTTTGACCTGGG + Intergenic
1015496101 6:133885012-133885034 TAAGTGGGCCAGAGAAAACTCGG - Intergenic
1024966197 7:55023976-55023998 CAAGCTGGCCAGTTTGAATTTGG + Intronic
1028897391 7:96057423-96057445 TAATTGGGTCAGTTAGAATTTGG + Intronic
1033286908 7:140049301-140049323 TAACTTGTCCAGTTTGAACATGG + Intronic
1043368643 8:79564912-79564934 TAAGTTGGCCCGAATGAACTGGG + Intergenic
1045681755 8:104668143-104668165 CAAGTGGGGCAGTTTAATCTGGG - Intronic
1050676576 9:8062640-8062662 TAAGTGGGCGAGCTTGTCCTCGG + Intergenic
1055112767 9:72575883-72575905 AAAGAGGGCCAGTTGAAACTGGG + Intronic
1055568940 9:77596876-77596898 AAGGTGGGACAGTTTGAAGTGGG - Intronic
1060997430 9:127883091-127883113 TGAGTGGGCCAGTCTCCACTGGG + Intergenic
1062103130 9:134738669-134738691 TTGGTTGGCCAGTTGGAACTTGG + Intronic
1203438323 Un_GL000195v1:164490-164512 TAAATAGGGCTGTTTGAACTGGG + Intergenic
1187141895 X:16601910-16601932 TAAAAGAGCCAGTTTGAACTCGG + Intronic
1188876958 X:35442017-35442039 AAGGTGGGCCAATTTGAAGTGGG + Intergenic
1190569811 X:51769692-51769714 AAGGTGGGACAATTTGAACTAGG - Intergenic
1198443873 X:136691906-136691928 TAAGTAGGTCACTTTGCACTAGG - Intronic