ID: 1070138768 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 10:73720341-73720363 |
Sequence | CCTCTTGTCTTGTAGCTAGA GGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1070138768_1070138772 | -4 | Left | 1070138768 | 10:73720341-73720363 | CCCTCTAGCTACAAGACAAGAGG | No data | ||
Right | 1070138772 | 10:73720360-73720382 | GAGGTCAGAGAAGAGGCATTCGG | No data | ||||
1070138768_1070138773 | 11 | Left | 1070138768 | 10:73720341-73720363 | CCCTCTAGCTACAAGACAAGAGG | No data | ||
Right | 1070138773 | 10:73720375-73720397 | GCATTCGGTAACACCTTTGCAGG | No data | ||||
1070138768_1070138775 | 26 | Left | 1070138768 | 10:73720341-73720363 | CCCTCTAGCTACAAGACAAGAGG | No data | ||
Right | 1070138775 | 10:73720390-73720412 | TTTGCAGGCCTACACATAGCTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1070138768 | Original CRISPR | CCTCTTGTCTTGTAGCTAGA GGG (reversed) | Intergenic | ||
No off target data available for this crispr |