ID: 1070138768

View in Genome Browser
Species Human (GRCh38)
Location 10:73720341-73720363
Sequence CCTCTTGTCTTGTAGCTAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070138768_1070138772 -4 Left 1070138768 10:73720341-73720363 CCCTCTAGCTACAAGACAAGAGG No data
Right 1070138772 10:73720360-73720382 GAGGTCAGAGAAGAGGCATTCGG No data
1070138768_1070138773 11 Left 1070138768 10:73720341-73720363 CCCTCTAGCTACAAGACAAGAGG No data
Right 1070138773 10:73720375-73720397 GCATTCGGTAACACCTTTGCAGG No data
1070138768_1070138775 26 Left 1070138768 10:73720341-73720363 CCCTCTAGCTACAAGACAAGAGG No data
Right 1070138775 10:73720390-73720412 TTTGCAGGCCTACACATAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070138768 Original CRISPR CCTCTTGTCTTGTAGCTAGA GGG (reversed) Intergenic
No off target data available for this crispr