ID: 1070138772

View in Genome Browser
Species Human (GRCh38)
Location 10:73720360-73720382
Sequence GAGGTCAGAGAAGAGGCATT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070138767_1070138772 13 Left 1070138767 10:73720324-73720346 CCACACTGGAACAGTGGCCCTCT 0: 4
1: 1
2: 1
3: 14
4: 130
Right 1070138772 10:73720360-73720382 GAGGTCAGAGAAGAGGCATTCGG No data
1070138770_1070138772 -5 Left 1070138770 10:73720342-73720364 CCTCTAGCTACAAGACAAGAGGT No data
Right 1070138772 10:73720360-73720382 GAGGTCAGAGAAGAGGCATTCGG No data
1070138768_1070138772 -4 Left 1070138768 10:73720341-73720363 CCCTCTAGCTACAAGACAAGAGG No data
Right 1070138772 10:73720360-73720382 GAGGTCAGAGAAGAGGCATTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070138772 Original CRISPR GAGGTCAGAGAAGAGGCATT CGG Intergenic
No off target data available for this crispr