ID: 1070138775

View in Genome Browser
Species Human (GRCh38)
Location 10:73720390-73720412
Sequence TTTGCAGGCCTACACATAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070138768_1070138775 26 Left 1070138768 10:73720341-73720363 CCCTCTAGCTACAAGACAAGAGG No data
Right 1070138775 10:73720390-73720412 TTTGCAGGCCTACACATAGCTGG No data
1070138770_1070138775 25 Left 1070138770 10:73720342-73720364 CCTCTAGCTACAAGACAAGAGGT No data
Right 1070138775 10:73720390-73720412 TTTGCAGGCCTACACATAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070138775 Original CRISPR TTTGCAGGCCTACACATAGC TGG Intergenic
No off target data available for this crispr