ID: 1070139401

View in Genome Browser
Species Human (GRCh38)
Location 10:73726973-73726995
Sequence GGCAAGGATGTGCATGCACC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070139397_1070139401 0 Left 1070139397 10:73726950-73726972 CCACTAGCATGTGGCTTCATAAG No data
Right 1070139401 10:73726973-73726995 GGCAAGGATGTGCATGCACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070139401 Original CRISPR GGCAAGGATGTGCATGCACC TGG Intergenic
No off target data available for this crispr