ID: 1070139436 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 10:73727336-73727358 |
Sequence | GCCTCATTCGGAACTTCACC CGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1070139436_1070139439 | 10 | Left | 1070139436 | 10:73727336-73727358 | CCGGGTGAAGTTCCGAATGAGGC | No data | ||
Right | 1070139439 | 10:73727369-73727391 | AGTGCTCTTTCCAACTTTGGAGG | No data | ||||
1070139436_1070139438 | 7 | Left | 1070139436 | 10:73727336-73727358 | CCGGGTGAAGTTCCGAATGAGGC | No data | ||
Right | 1070139438 | 10:73727366-73727388 | CAAAGTGCTCTTTCCAACTTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1070139436 | Original CRISPR | GCCTCATTCGGAACTTCACC CGG (reversed) | Intergenic | ||