ID: 1070139436

View in Genome Browser
Species Human (GRCh38)
Location 10:73727336-73727358
Sequence GCCTCATTCGGAACTTCACC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070139436_1070139439 10 Left 1070139436 10:73727336-73727358 CCGGGTGAAGTTCCGAATGAGGC No data
Right 1070139439 10:73727369-73727391 AGTGCTCTTTCCAACTTTGGAGG No data
1070139436_1070139438 7 Left 1070139436 10:73727336-73727358 CCGGGTGAAGTTCCGAATGAGGC No data
Right 1070139438 10:73727366-73727388 CAAAGTGCTCTTTCCAACTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070139436 Original CRISPR GCCTCATTCGGAACTTCACC CGG (reversed) Intergenic