ID: 1070142651

View in Genome Browser
Species Human (GRCh38)
Location 10:73749845-73749867
Sequence CTGCTCTTCTTGAGAAAGTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 229
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 215}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070142651_1070142654 5 Left 1070142651 10:73749845-73749867 CCTTACTTTCTCAAGAAGAGCAG 0: 1
1: 0
2: 1
3: 12
4: 215
Right 1070142654 10:73749873-73749895 ACTCTACCGATTCTCCAGAGGGG No data
1070142651_1070142656 13 Left 1070142651 10:73749845-73749867 CCTTACTTTCTCAAGAAGAGCAG 0: 1
1: 0
2: 1
3: 12
4: 215
Right 1070142656 10:73749881-73749903 GATTCTCCAGAGGGGCTTTTTGG No data
1070142651_1070142652 3 Left 1070142651 10:73749845-73749867 CCTTACTTTCTCAAGAAGAGCAG 0: 1
1: 0
2: 1
3: 12
4: 215
Right 1070142652 10:73749871-73749893 GTACTCTACCGATTCTCCAGAGG No data
1070142651_1070142653 4 Left 1070142651 10:73749845-73749867 CCTTACTTTCTCAAGAAGAGCAG 0: 1
1: 0
2: 1
3: 12
4: 215
Right 1070142653 10:73749872-73749894 TACTCTACCGATTCTCCAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070142651 Original CRISPR CTGCTCTTCTTGAGAAAGTA AGG (reversed) Intronic
900710344 1:4109434-4109456 CTGGACTTCATGAGAAAATAGGG + Intergenic
905521380 1:38603150-38603172 CTGCACTTCTGGAGAAAAAAAGG + Intergenic
905773384 1:40652871-40652893 CTGCACTGCTTTAGAAAGTGAGG + Intronic
905881536 1:41467321-41467343 GTGCACTTCTGGAGAAAGGAGGG + Intergenic
906584130 1:46961552-46961574 CTGCTCTTCCTGAGAACAAAGGG + Intergenic
907629324 1:56064074-56064096 CTGCTTTTCTAGAGAAATCAAGG + Intergenic
910503234 1:87918705-87918727 CTGCTGTGCTTGAGACAGCATGG - Intergenic
910659837 1:89660070-89660092 GTGCTCTTCTTGAGAGAGGGTGG + Intronic
911099718 1:94085649-94085671 CTTCTCTTCTGGAGACAGTAGGG - Intronic
912192757 1:107359425-107359447 CTTCTCTTCCTGGGAAACTAAGG - Intronic
913139597 1:115927570-115927592 CTGCTATTGATGAAAAAGTAAGG - Intergenic
913164629 1:116173609-116173631 CTGCTCATCTGGAGAATGTGGGG - Intergenic
913443226 1:118921663-118921685 CTGCTTTTCCTTAGAAAGTCTGG + Intronic
913996192 1:143653457-143653479 CTCCTCTTTTGGAGAAAGGAGGG - Intergenic
914376626 1:147078465-147078487 CTCCTCTTTTGGAGAAAGGAGGG + Intergenic
914492749 1:148162406-148162428 CTCCTCTTTTGGAGAAAGGAGGG - Intergenic
915119368 1:153619075-153619097 CTGGGGTTCTTGAGAAAGTAGGG + Intronic
916707820 1:167371119-167371141 CTCCTCTCCCTCAGAAAGTAAGG - Intronic
917153320 1:171967490-171967512 CTCTTCTTCTTGGGAAAATAAGG - Intronic
917327858 1:173851537-173851559 CTGCTGTTCTTGAGGAAAAAGGG - Intronic
918268438 1:182870353-182870375 CTGCTCTTCTTTAGAAATACTGG - Intronic
918665870 1:187150309-187150331 CTGCTCTTGTAGAGTAAGTTTGG + Intergenic
919044089 1:192429629-192429651 ATGCTGTTCTTGTGATAGTAAGG + Intergenic
920384180 1:205556421-205556443 CAGCTGTTCTTGAGTAAGCATGG - Intergenic
922244615 1:223783392-223783414 CTGCTGTTGGTGAGGAAGTAAGG - Intronic
922921010 1:229303445-229303467 ATGCTCTTGTTCAGAAAGAAAGG + Intronic
923217598 1:231863723-231863745 CTGGGCTTTTTAAGAAAGTAGGG + Intronic
923955429 1:239013124-239013146 CTGCCCTACTTGAGAGACTAGGG + Intergenic
1068771641 10:60828189-60828211 CTTCCCTTGTTGAGAAAGGAAGG + Intergenic
1068786662 10:60983211-60983233 CTTCTCATTTAGAGAAAGTAGGG - Intronic
1069177683 10:65313855-65313877 ATGCTTTTCTTGGGAAAATATGG - Intergenic
1070012355 10:72488805-72488827 CTGGAGTTATTGAGAAAGTATGG + Intronic
1070142651 10:73749845-73749867 CTGCTCTTCTTGAGAAAGTAAGG - Intronic
1071457590 10:85862838-85862860 TTGATCTTCATGAGAAAATAAGG + Intronic
1071875129 10:89836859-89836881 TTGCTGTTCTTGAGAAACTGAGG - Intergenic
1073206792 10:101773690-101773712 CTCCTCTTCTTGAGCCAGTTTGG - Intronic
1073737577 10:106367445-106367467 CTCCTCTTCTTGAGTATGAATGG - Intergenic
1074824920 10:117207781-117207803 CTGCACTTCTGGAGGAAGTTGGG + Intronic
1076729181 10:132429751-132429773 CTGCTCTCCTGGAGACAGCATGG - Intergenic
1078643778 11:13119545-13119567 CTGTTGTTATTGAGAAAATAGGG - Intergenic
1078681154 11:13477413-13477435 TTTCTCTTCTTGAGAAATTATGG + Intergenic
1080439619 11:32279871-32279893 TTGCTCTTTTAGAGAAACTATGG - Intergenic
1080747892 11:35125579-35125601 CTTCTTTTCTTGACAAAATAGGG - Intergenic
1080787215 11:35486567-35486589 CTGCTGTCCTTGAGAAAGCCTGG + Intronic
1086866222 11:91983113-91983135 CTGCTCTTCTTGTTAAATTCTGG - Intergenic
1089127552 11:116187512-116187534 TTGCTCTTCTTGATGCAGTAGGG - Intergenic
1089719821 11:120405216-120405238 CTGATGTTCTTAATAAAGTACGG + Intronic
1091285500 11:134406288-134406310 CTGCTCTTATTCTGAAAGTGTGG + Intronic
1091388113 12:107973-107995 CTCCTCCTCTTCAGAAAGTTGGG + Intronic
1092469478 12:8765166-8765188 CTGCCCTTCTGGAGAGACTAAGG - Intronic
1092851974 12:12637625-12637647 CTGCTCTTCTCCAGTGAGTAGGG - Exonic
1092999504 12:13981628-13981650 CACCTCTTTTTGAGAAAGGAAGG - Intergenic
1093532089 12:20177634-20177656 CTTTTCTTCGAGAGAAAGTATGG - Intergenic
1094789899 12:33900355-33900377 CCTATTTTCTTGAGAAAGTAGGG + Intergenic
1096216592 12:49801191-49801213 CTTCTCTTCTTGTCAAAGTGAGG + Intronic
1098582705 12:72120024-72120046 ATGCTATTATTGATAAAGTAAGG + Intronic
1098836585 12:75430513-75430535 CTGGTCTGCTACAGAAAGTATGG - Intronic
1103233117 12:119349193-119349215 CTGCTCTTCTTTTGAGAGTGGGG - Intronic
1104181256 12:126383619-126383641 CTGCTCTTCCTAAGAAAATGAGG - Intergenic
1104286367 12:127428381-127428403 CTCCTCTTCTTCCGGAAGTAGGG - Intergenic
1104306397 12:127614114-127614136 CTTCTCTTTTTGAGAGAGCAGGG - Intergenic
1105821413 13:24084308-24084330 CTGCTTCTTTTGAGAAAGGAAGG + Intronic
1107157569 13:37187182-37187204 CTGCTTTGCTGGAGGAAGTATGG + Intergenic
1108095813 13:46899583-46899605 CTGTTCTTCATGAGAAATAATGG - Intergenic
1108258221 13:48630897-48630919 CTGCTCTTCTAGAAATAGTTTGG - Intergenic
1108782505 13:53853738-53853760 CTGCTCTCCCAGAGAAAGTTGGG - Intergenic
1108927902 13:55776164-55776186 TTGATCTTTATGAGAAAGTAGGG - Intergenic
1108944798 13:56008768-56008790 GGGCTGTTCTTCAGAAAGTATGG + Intergenic
1109931726 13:69225180-69225202 CTGCCTTTCTGGAGAGAGTAAGG + Intergenic
1111886357 13:94026865-94026887 CTGCTATTCTTGTGATAGTGAGG - Intronic
1112975592 13:105313838-105313860 CTGCTCCACGTGAGCAAGTATGG - Intergenic
1113555440 13:111230304-111230326 CTGCTTTTCTTAGGATAGTAGGG + Intronic
1115662128 14:35507016-35507038 CTGTTCTTCCTGAGACAGGATGG - Intergenic
1115758526 14:36554350-36554372 CTTCTCTTATTGAGAAAATCAGG + Intergenic
1117846876 14:59920586-59920608 CTGCTCATCTAGAGAGTGTAGGG + Intronic
1117896757 14:60495371-60495393 CAGATCTTCTTCAGAATGTAAGG - Intronic
1120617293 14:86723195-86723217 TTCCTCTTCTTTAAAAAGTAAGG + Intergenic
1124015690 15:25872806-25872828 CTCCTCTTCTGGAGAAGGGATGG - Intergenic
1125966097 15:43876730-43876752 CTGCTCTTCTTGAGGGGGCATGG + Intronic
1126630132 15:50726067-50726089 CAGCTCCCCATGAGAAAGTAAGG - Intronic
1127617274 15:60699554-60699576 CACCTCTTCTTTAGAAAATAAGG + Intronic
1130395865 15:83500727-83500749 CAGCTCTTTGTGAGAAAGTCCGG + Intronic
1131158017 15:90086887-90086909 CTGCTCTTAGAGAGAAAGGAGGG - Intronic
1131433971 15:92408466-92408488 GTGCTCTTTTGGAGAAAGAAGGG + Intronic
1132130663 15:99275490-99275512 ATGCTCCTCGAGAGAAAGTAAGG - Intronic
1135224712 16:20645878-20645900 CTGCTCTTCTGGAGAGACAAAGG + Intronic
1135988053 16:27198735-27198757 CTGCTTTTCATGAAAAAGAAAGG - Intergenic
1138924600 16:61576036-61576058 CTGCTCTTCTAGAGAAGCTGAGG + Intergenic
1140852721 16:78949877-78949899 CTGCTACTATTAAGAAAGTAGGG - Intronic
1147369767 17:39984280-39984302 CTGCTCTTCTTCAGACATCAAGG + Exonic
1147910886 17:43855298-43855320 CTGCTCCTGTGGAGAAAGGAAGG + Exonic
1148583103 17:48757167-48757189 CTCCTATGCTTGAGAAAGCAGGG + Intergenic
1149811194 17:59674194-59674216 CTGCTATTATTGAAAAAGTTGGG + Intronic
1154002369 18:10493352-10493374 TTGCTCTTTTTGAGAAAGCCAGG - Intergenic
1155596080 18:27489178-27489200 CTTCTCTTCTTGTAAAAGTCTGG + Intergenic
1155828264 18:30477626-30477648 CTTCTCTTCTTCAAAAAATAGGG + Intergenic
1158852753 18:61512114-61512136 TTCCTCTTTTTGAAAAAGTATGG - Intronic
1164237248 19:23347896-23347918 CTGCTCACCCAGAGAAAGTACGG - Intronic
925321190 2:2970416-2970438 CTGCTCTTCATGTGGAACTAAGG + Intergenic
926071425 2:9896223-9896245 CTCCTCTTCTTGAAAAAAGAGGG - Intronic
926512414 2:13798883-13798905 CTGTTATTCTTGAGACAGTTTGG - Intergenic
931518342 2:63067950-63067972 CTGTTCATCTGGAGAAAGCAGGG + Intergenic
941093523 2:161208400-161208422 GTACTCTGCTTGAGACAGTAGGG + Intronic
941328674 2:164149265-164149287 GTGCTTCTCTTGAAAAAGTAGGG + Intergenic
941345382 2:164362062-164362084 ATGCTTTTCTTGGGAAAGGATGG + Intergenic
944039366 2:195336713-195336735 CTGCTTTTCTGGAGAGACTAAGG - Intergenic
945608268 2:211964226-211964248 CTCCTCTTCTGGAGAATGAATGG + Intronic
1169461191 20:5797141-5797163 CTACTCTTCTTGATGAAATAAGG + Intronic
1170220517 20:13936888-13936910 CTGCTCTTCCTGAGAACTGAAGG - Intronic
1170503975 20:17004826-17004848 CTTCTCTTTTTGAGAAAGAAGGG - Intergenic
1175033985 20:55982338-55982360 ATGCTGTTCTTGAGATAGTGAGG + Intergenic
1175950744 20:62581860-62581882 CTGCTCTTATTTAGAAATTTTGG + Intergenic
1178794155 21:35728134-35728156 CTGCCCCTCTTGAGACAGCAAGG + Intronic
1182746906 22:32612977-32612999 TTGCTGTTCTTGCGATAGTAAGG + Intronic
1182852334 22:33485967-33485989 CTGCTCTTCTTGAGATAATCAGG - Intronic
1183342453 22:37289112-37289134 CTGGTCTTCTGGAGAAAAGATGG + Intronic
950854428 3:16091921-16091943 CTGCACTCTTTGAGAAAGCAGGG - Intergenic
951235086 3:20225655-20225677 CTACTTTTGTTGAAAAAGTATGG - Intergenic
952067392 3:29587533-29587555 CTGTTCTGCTTGAGAAAGATGGG + Intronic
953085641 3:39664082-39664104 CTCCTGTTTCTGAGAAAGTAGGG + Intergenic
955006795 3:54976170-54976192 CTGCTGTCTTTTAGAAAGTAAGG + Intronic
956441364 3:69283513-69283535 CTGTTTGTCTTGAGAAAGCAAGG - Intronic
957432359 3:80127211-80127233 CTGCACTTCTTTAAAAACTAAGG + Intergenic
957515401 3:81244312-81244334 CTGCTCTTCTGGATAAATAAAGG - Intergenic
958874456 3:99600110-99600132 CTGTCCTTCCTGAGAAAGCAAGG + Intergenic
959479402 3:106853408-106853430 CTACTCTCCTACAGAAAGTATGG - Intergenic
959551740 3:107667090-107667112 CTGTTCTTCTTGAGATAGGGTGG - Intronic
961020291 3:123499832-123499854 CTCCTCATCCTCAGAAAGTAGGG + Intronic
961116284 3:124332784-124332806 CTGCTTTTCAGGAGAAAGAAAGG + Intronic
962010012 3:131383082-131383104 CTGATCTGCTGGAGAAAGGATGG + Exonic
962968870 3:140380537-140380559 CATTTCTTCTTGAGAAAATATGG + Intronic
963380688 3:144526240-144526262 CTGCTGTACTTATGAAAGTAGGG - Intergenic
965513964 3:169600730-169600752 TTGCTCTCCTTTAAAAAGTATGG + Intronic
967268605 3:187714295-187714317 CAGCTCTTCTCGAAAAGGTAAGG - Intronic
967334714 3:188330963-188330985 ATGGTCTTCTGGTGAAAGTAAGG - Intronic
968830022 4:2928482-2928504 TTGCTCTTCTTCAGAAAGGACGG - Exonic
969289384 4:6228933-6228955 GTGCTGTTCTGGAGAAAGTATGG - Intergenic
970606479 4:17686504-17686526 CTGCTCTTATGGAGAGAGGAGGG + Intronic
970673458 4:18421664-18421686 CTTCCCTTCTAGAGAAAGAAGGG - Intergenic
970769068 4:19588324-19588346 CTGATTTGCTTGAGAAAGCAAGG + Intergenic
970850864 4:20601204-20601226 CTGCTGTTCTAGAGATAGTCTGG + Intronic
972688517 4:41373866-41373888 TTGCTGTTCTTGAGATAGTGAGG + Intronic
972910806 4:43814000-43814022 CTTCGCTTGTTGAGAAACTAAGG + Intergenic
977618031 4:99106831-99106853 CTGCTTTTCTGGAGAGACTAAGG - Intergenic
978024587 4:103856807-103856829 CTGCCATTTTTAAGAAAGTAAGG + Intergenic
978924972 4:114231909-114231931 CTGCTCTGGTGGAGAAAGCAGGG - Intergenic
979482112 4:121231242-121231264 CTGCTCTTCATAAAAAAGAATGG + Intergenic
980875085 4:138653501-138653523 TTGCTCTTCATAATAAAGTAAGG - Intergenic
983017370 4:162629366-162629388 CTGTTCTTCTTGGGAAGGGAAGG - Intergenic
984321248 4:178199142-178199164 CTGCTCTTCTTAACAAAGTCTGG + Intergenic
986099797 5:4596549-4596571 CTGCTCTTCTTAGCAAGGTATGG + Intergenic
987208113 5:15648787-15648809 ATGATCTTCCTGAGAAACTATGG + Intronic
989489909 5:42038120-42038142 ATGCTCTACCTGAGAATGTAAGG - Intergenic
989619444 5:43369924-43369946 CTACTCTACTAGAGATAGTATGG + Intergenic
990476049 5:56162594-56162616 CTGCTCTTTTGGGGAAAGTGGGG + Intronic
991950646 5:71944110-71944132 CTGCTCTTCAAGAGAAGGAAAGG + Intergenic
992549648 5:77848420-77848442 CTTCTTTTCTTTACAAAGTAGGG + Intronic
994549279 5:101209513-101209535 CTGCTGTTCTTGTGATAGTGTGG + Intergenic
994581439 5:101647937-101647959 CTGCTCTACTTGAGAATTCAGGG - Intergenic
995387590 5:111605003-111605025 TTACTCTTTTTGAGAAACTATGG - Intergenic
995560569 5:113376815-113376837 ATGCTCAGCTTGAGAAATTAGGG - Intronic
997997247 5:138596674-138596696 CTGCTCTTGATGAAAAAGTCAGG + Intergenic
999558280 5:152769154-152769176 TTGCTATTCCTGAGACAGTAAGG + Intergenic
1004296396 6:14415753-14415775 CTGCTGTTCTTGTGATAGTAAGG + Intergenic
1004972089 6:20921849-20921871 CTGCAATTGTTGAGAAACTACGG - Intronic
1005894310 6:30164494-30164516 CTCTTCTTCTTGAGAAAGGGAGG + Intronic
1006267310 6:32936021-32936043 CTGCTCAGTTGGAGAAAGTAAGG - Intronic
1007692225 6:43710012-43710034 GAGCTCTTGTGGAGAAAGTACGG - Intergenic
1009589184 6:65643684-65643706 CTGCTCTGGTGGAGATAGTAGGG - Intronic
1010439260 6:75874548-75874570 TCCCTCTTGTTGAGAAAGTAGGG + Intronic
1011429166 6:87266925-87266947 CTACTATTCTTGAAAAAATAGGG + Intergenic
1012456008 6:99406073-99406095 GTGCTCTTCTTGAGGAACTGGGG + Exonic
1012594861 6:101027719-101027741 GTGTCCTTTTTGAGAAAGTAAGG + Intergenic
1013013430 6:106140670-106140692 CTGGTCCTCTTGAGAAACCAAGG + Intergenic
1016786039 6:148011538-148011560 CTGCTGTTCTTGTGATAGTGAGG + Intergenic
1016899587 6:149088503-149088525 CAGTTCTTCTTGAGCAAGAAAGG - Intergenic
1018761028 6:166894527-166894549 CTGCTTTTCTGGAGAGACTAAGG + Intronic
1019657038 7:2201374-2201396 CTGCTCTACCTGTAAAAGTAGGG + Intronic
1020857929 7:13452071-13452093 CTGCTGTTCTTGTGATAGTGAGG + Intergenic
1020963812 7:14840785-14840807 ATGCTGTGCTTGAGACAGTATGG - Intronic
1021821581 7:24503485-24503507 GTGCTCTTCTAGAGGAAGCAGGG - Intergenic
1023263495 7:38381302-38381324 CTGCTCTTCCTGACAAAGCTGGG - Intergenic
1023912037 7:44563127-44563149 CTGCCTTCCTTGAGAAAGTGAGG - Intergenic
1024273341 7:47658676-47658698 CTGCTCTTATTGTGCAGGTAAGG + Exonic
1024345462 7:48309165-48309187 GTGCTCTTCTTCAGAGAGCATGG + Intronic
1024673929 7:51621258-51621280 TTCCTTTTCTTGAGAATGTATGG + Intergenic
1025264961 7:57449320-57449342 ATGCTATTCTTGTGATAGTAAGG - Intergenic
1025746564 7:64248195-64248217 ATGCTGTTCTTGTGATAGTAAGG - Intronic
1026624904 7:71983159-71983181 TTGCTCTTCTCGAGAGAGAAGGG - Intronic
1026671266 7:72392647-72392669 TTGCTCCTATTGAGAAAGTGGGG - Intronic
1027426876 7:78069952-78069974 GTGCTCTTCTTGATGAAGTTTGG + Intronic
1028570511 7:92281287-92281309 CTGCTTTTCTTCAGAAAGTCTGG - Intronic
1028997775 7:97120375-97120397 CTGGTCTTTTTGAAAGAGTAGGG + Intronic
1030151263 7:106407562-106407584 CTGATATTCATGAGAAATTATGG + Intergenic
1031297147 7:120015057-120015079 CTGTTCTTTCTGAGGAAGTAGGG - Intergenic
1032820614 7:135521011-135521033 ATGCCCTACTTAAGAAAGTAAGG + Intergenic
1039252425 8:35681569-35681591 CTGCTCTGTTTAACAAAGTAGGG - Intronic
1039726516 8:40223122-40223144 CTACACTTATTGAGAAAGTGTGG - Intergenic
1040632419 8:49230724-49230746 ATGCTCTTCATAAGAGAGTAAGG + Intergenic
1041579393 8:59439890-59439912 CTGCTTATCTTGAGAAGGGAAGG + Intergenic
1043773192 8:84231036-84231058 CTTCTCTTCTGGAGAAAGTCTGG - Intronic
1044811168 8:96063699-96063721 CTGGTCTTCTTGATGAAGTGAGG - Intergenic
1045778435 8:105834885-105834907 CTGCTCTTAGTAAGAAAGAAAGG - Intergenic
1045849147 8:106672751-106672773 CTGTTCTTCTTGTGATAGTGAGG + Intronic
1046595550 8:116257103-116257125 CTGCTCTTCTCTGGAAAGCAGGG + Intergenic
1048034729 8:130666639-130666661 CTGTTCTTCTTCAGATATTAAGG + Intergenic
1048525614 8:135199712-135199734 CTGCTCTTCTTTAGGAAATTAGG - Intergenic
1049373637 8:142279151-142279173 CTGCCCTGCATGGGAAAGTAGGG + Intronic
1051557962 9:18405994-18406016 TAGCTCTTCTTGAGAATGTTAGG + Intergenic
1051986809 9:23098950-23098972 CAGCTTTTCTGGAGAAATTAAGG + Intergenic
1052081117 9:24206674-24206696 CTCCTCTTGATGAGAAAGCAGGG - Intergenic
1052837555 9:33263422-33263444 CGTCTCTTCTTCAGAAAGAAAGG - Intronic
1053305607 9:36982439-36982461 CTTCTCTCCTTGACAGAGTATGG - Intronic
1055157604 9:73083288-73083310 CTGCTCTTCTTGTGATAGTAAGG - Intergenic
1055175041 9:73307426-73307448 CTGCTTTCTTTGAGAATGTAAGG + Intergenic
1055636869 9:78287588-78287610 CTGCTTTTCATGAGAAAACAAGG + Intergenic
1056896657 9:90557224-90557246 CTTCTCTCCTTGAGTAAATATGG + Intergenic
1058234963 9:102478465-102478487 CTGCATCTCTTGAGAAAGTATGG - Intergenic
1058587514 9:106526183-106526205 CTCATCTTCATGAGAAAATATGG - Intergenic
1059486131 9:114628273-114628295 CCGCTCTTCTGGAGAGAGTGTGG - Intronic
1060959501 9:127669998-127670020 CTGCTCTTAGAGAGAAAGCAGGG - Intronic
1188851935 X:35142874-35142896 CTGATCATCATGAGGAAGTAAGG - Intergenic
1188973031 X:36640174-36640196 CTGATCATCATGAGCAAGTAAGG + Intergenic
1190265513 X:48825538-48825560 CTCCTCTTCTTGACTCAGTAAGG - Intergenic
1193171987 X:78347474-78347496 CTGCCTTTCTTGAGAGACTAAGG - Intergenic
1197346769 X:125333794-125333816 ATGCTGTTCTTGTGACAGTAAGG - Intergenic
1199627807 X:149757292-149757314 TAGCCCTTCTTGAGCAAGTATGG - Intergenic
1199868459 X:151875323-151875345 CTGCTGTTCTTGGGCAAGCAAGG - Intergenic
1202012603 Y:20361312-20361334 CTGTTCTTTTTGAGAAAGCTAGG + Intergenic