ID: 1070143448

View in Genome Browser
Species Human (GRCh38)
Location 10:73756157-73756179
Sequence GTGAGGACTGAAAATCAGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070143439_1070143448 25 Left 1070143439 10:73756109-73756131 CCCAAAGTGGTGGGATTACAGGC 0: 1767
1: 235688
2: 277085
3: 179783
4: 136864
Right 1070143448 10:73756157-73756179 GTGAGGACTGAAAATCAGAGTGG No data
1070143440_1070143448 24 Left 1070143440 10:73756110-73756132 CCAAAGTGGTGGGATTACAGGCA 0: 786
1: 99218
2: 241742
3: 242690
4: 211531
Right 1070143448 10:73756157-73756179 GTGAGGACTGAAAATCAGAGTGG No data
1070143444_1070143448 -3 Left 1070143444 10:73756137-73756159 CCACTGTGCCTGGCCATCAAGTG 0: 1
1: 7
2: 92
3: 694
4: 3734
Right 1070143448 10:73756157-73756179 GTGAGGACTGAAAATCAGAGTGG No data
1070143437_1070143448 28 Left 1070143437 10:73756106-73756128 CCTCCCAAAGTGGTGGGATTACA 0: 2343
1: 312754
2: 267635
3: 146233
4: 128732
Right 1070143448 10:73756157-73756179 GTGAGGACTGAAAATCAGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070143448 Original CRISPR GTGAGGACTGAAAATCAGAG TGG Intronic
No off target data available for this crispr