ID: 1070145285

View in Genome Browser
Species Human (GRCh38)
Location 10:73769464-73769486
Sequence ATCAACTACATGGCCAAGTT TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 109
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 103}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070145282_1070145285 21 Left 1070145282 10:73769420-73769442 CCCAGCTGGCTGATCTATATCGA 0: 1
1: 0
2: 0
3: 6
4: 30
Right 1070145285 10:73769464-73769486 ATCAACTACATGGCCAAGTTTGG 0: 1
1: 0
2: 0
3: 5
4: 103
1070145283_1070145285 20 Left 1070145283 10:73769421-73769443 CCAGCTGGCTGATCTATATCGAA 0: 1
1: 0
2: 0
3: 1
4: 30
Right 1070145285 10:73769464-73769486 ATCAACTACATGGCCAAGTTTGG 0: 1
1: 0
2: 0
3: 5
4: 103

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070145285 Original CRISPR ATCAACTACATGGCCAAGTT TGG Exonic
904757464 1:32776024-32776046 ACCAACTTCATGACCAAGCTGGG - Exonic
905216628 1:36412962-36412984 CTCAACTGCATGGCCAGGTGTGG - Intergenic
907057831 1:51388046-51388068 TCCAACTACATGGTCAATTTTGG - Intronic
907231935 1:53007353-53007375 TCCAACTACATGGTCAATTTTGG - Intronic
909913628 1:81291123-81291145 TTTAACTCCATTGCCAAGTTTGG + Intergenic
909989255 1:82202195-82202217 ATAAACTACATGGACTAGTCAGG + Intergenic
910069250 1:83191399-83191421 ATAAATTACATGGACAAGTGTGG + Intergenic
910839953 1:91551686-91551708 ATATACTGAATGGCCAAGTTGGG - Intergenic
916837892 1:168567470-168567492 ACCAAGTTCATGGCCAAGCTGGG - Intergenic
1066427467 10:35321169-35321191 ATCAAAAACATGGACTAGTTAGG + Intronic
1068426626 10:56873922-56873944 ATCAACCAAATGGACAAGTATGG + Intergenic
1068458036 10:57285563-57285585 ATAAGCCACATGGCCAATTTTGG - Intergenic
1070145285 10:73769464-73769486 ATCAACTACATGGCCAAGTTTGG + Exonic
1071806017 10:89121977-89121999 AGCAATTTCATGGCCATGTTGGG + Intergenic
1072817313 10:98522150-98522172 ATCAACTACATGGGATTGTTAGG + Intronic
1073315781 10:102579887-102579909 TTCTACCACATGACCAAGTTGGG + Intronic
1076486237 10:130820236-130820258 ATAAAGCACATGGTCAAGTTTGG - Intergenic
1078394810 11:10971744-10971766 ATCAAATCCATGGGCAAGGTGGG - Intergenic
1079045953 11:17103493-17103515 ATTAACTACATGGGCAAGTCAGG - Intronic
1080144048 11:28958143-28958165 ACCAACTACATGGCAAAATATGG + Intergenic
1085824508 11:79830116-79830138 ATCAAATACATGGTGAAGCTTGG + Intergenic
1087137238 11:94733000-94733022 ATCATGTACATGGCAATGTTTGG - Intronic
1087371854 11:97294115-97294137 TTCATCTACCTGGCCAGGTTAGG + Intergenic
1094442962 12:30499840-30499862 ATTAACGAGATGGCCAAGTGTGG - Intergenic
1099398790 12:82176567-82176589 ATGAACTACATAGCAAAGTATGG - Intergenic
1107897578 13:44981519-44981541 ATCAACTATATGGCCAGGCATGG + Intronic
1108085726 13:46790130-46790152 TTCAAGTACATGGCCAGGTGTGG - Intronic
1117284606 14:54274954-54274976 GTCTACTACATGGCCAGCTTGGG - Intergenic
1124896887 15:33785733-33785755 ATCAACGACCTGGCCGAGTCAGG + Exonic
1126587698 15:50305935-50305957 AAAAACTACATGGCCAGGTGTGG - Intronic
1130674281 15:85938429-85938451 ACCCACCACTTGGCCAAGTTGGG + Intergenic
1133000998 16:2851693-2851715 ATCAAGGGCATGGCCAAGTTTGG - Intergenic
1141581672 16:85003767-85003789 ATCAAAAACATGGCAAAGTGGGG + Intronic
1141816694 16:86415361-86415383 ATCAACCTCAGGGCCATGTTTGG + Intergenic
1141866162 16:86751606-86751628 AGTAACAACATGGCCAAGGTTGG + Intergenic
1146576205 17:33994039-33994061 ATCTAATACATGTCTAAGTTTGG - Intronic
1148609047 17:48951792-48951814 AACAACTACCTTGCCAGGTTGGG + Intergenic
1155781405 18:29841090-29841112 TTCAACTATTTGGCAAAGTTGGG + Intergenic
1163704437 19:18804142-18804164 AGCAACAACATGGCCAAGGTGGG - Intergenic
1164361595 19:27518488-27518510 TCCAACTACATGGTCAATTTTGG + Intergenic
925978263 2:9156092-9156114 TTCCAGTGCATGGCCAAGTTTGG - Intergenic
927879843 2:26682560-26682582 TCCAACTAAATGGACAAGTTTGG - Intergenic
929238794 2:39632329-39632351 TTCAACTACATGGCAGAGTAAGG - Intergenic
932325603 2:70858918-70858940 ATCCCCAACATGGCAAAGTTGGG + Intergenic
933845314 2:86321602-86321624 AACAACTTCATGACCAAATTGGG + Intronic
938801824 2:134770895-134770917 ATCAAGTACATTACCATGTTGGG - Intergenic
938860987 2:135369097-135369119 ATCAACTACTGAGACAAGTTAGG - Intronic
939975046 2:148707574-148707596 TCCAACTACATGGTCAATTTTGG - Intronic
947844499 2:233232974-233232996 ATCAACAAGGTGGCCAAGATGGG - Intronic
1174242507 20:49148958-49148980 AACAACAACATGGCCAGGTATGG + Intronic
1174305836 20:49613726-49613748 ATCAACCCCATAGCCTAGTTAGG - Intergenic
1174950389 20:55035735-55035757 ATGAACCCCAAGGCCAAGTTGGG + Intergenic
1177571221 21:22889499-22889521 AGAAACTACAGGGCCAGGTTTGG + Intergenic
1182469651 22:30540423-30540445 ATCAATTACTTGGCCAGGTGAGG + Intronic
951980128 3:28556666-28556688 ACCAACTTGATGGCCAAGTCTGG - Intergenic
953416678 3:42724580-42724602 ATCAAATACATTGACAAATTAGG - Intronic
956053931 3:65278485-65278507 ATCACTTACAGGGCCAAGGTGGG - Intergenic
956687807 3:71847369-71847391 ATCAGCTACATGGCACAGTAAGG - Intergenic
963679000 3:148349976-148349998 TGCAACTACATGGTCAATTTTGG - Intergenic
969650808 4:8466974-8466996 ATCAACTACAAGGCCAGGCGCGG - Intronic
970975440 4:22038262-22038284 TCCAACTACATGGTCAATTTTGG + Intergenic
970983231 4:22125881-22125903 TCCAACTACATGGTCAATTTTGG - Intergenic
976633336 4:87262321-87262343 AATAACTACATGGCCAGGTGTGG + Intergenic
977683244 4:99817960-99817982 ATCAATTACATAGCAAAGCTGGG + Intronic
979269131 4:118739148-118739170 ATCAACTTCTTTGCCAAGTCAGG - Exonic
979391198 4:120130021-120130043 ATTAACTACAGGAGCAAGTTTGG + Intergenic
980469181 4:133228618-133228640 ATCAACTTCCTGGGGAAGTTAGG - Intergenic
980651688 4:135725301-135725323 ATCAAATATATGGTAAAGTTTGG - Intergenic
984634046 4:182092051-182092073 ATAAACTACAAGGCCACGGTGGG + Intergenic
986077520 5:4353459-4353481 ATTAACTAGATGCCCAAGTTAGG - Intergenic
990239449 5:53802033-53802055 TTCAACTACGTGGTCAATTTTGG - Intergenic
990561953 5:56992187-56992209 ATCACCTACATTCCCAAGATAGG - Intergenic
990578574 5:57147294-57147316 ATCACCTACATTCCCAAGATAGG + Intergenic
993610040 5:90042951-90042973 TCCAACTACATGGTCAATTTTGG + Intergenic
993706297 5:91174998-91175020 ATTAAATTCATGGCCAAATTAGG + Intergenic
993809630 5:92459288-92459310 CTCAACTACATTGCAAAGTGAGG - Intergenic
993913661 5:93714343-93714365 ATTCACCACATGACCAAGTTTGG + Intronic
994528282 5:100933506-100933528 TTCAACTATATGGTCAATTTTGG + Intergenic
995251881 5:110002788-110002810 AACAAGAATATGGCCAAGTTGGG + Intergenic
996431118 5:123378776-123378798 AGCAACTAAATAGCCAAGTGTGG + Intronic
997084490 5:130782445-130782467 TTCAAGTTCATGGCCAATTTTGG - Intergenic
998032243 5:138880583-138880605 CTGAAATACATAGCCAAGTTTGG + Intronic
1003333622 6:5150407-5150429 AACTAATACATGGCCAAGCTGGG - Intronic
1008084305 6:47228195-47228217 ATCAACTAAATGTCCACGTATGG + Intergenic
1009240676 6:61182504-61182526 ATCAAACACTTAGCCAAGTTTGG + Intergenic
1010161090 6:72856811-72856833 ATCTACTCCATGGCCAACTCTGG + Intronic
1011577545 6:88819578-88819600 ATGAATTACATGGAAAAGTTAGG - Intronic
1012488813 6:99754445-99754467 ACCAACCACAAGGCTAAGTTTGG - Intergenic
1013574449 6:111467448-111467470 ATCAACCACATGGGTATGTTAGG - Intronic
1014898534 6:126933722-126933744 ATCAGCTCCATGGCCAGGTGCGG - Intergenic
1015511289 6:134040482-134040504 ATTAACTAAAAGACCAAGTTGGG + Intronic
1023125102 7:36947502-36947524 ATCAACGTCATGGCCCAGATTGG - Intronic
1025595913 7:62925718-62925740 ATCCACTTCATGGCCAGGTGCGG + Intergenic
1027287029 7:76656580-76656602 ATAAATTACATGGACAAGTGTGG + Intergenic
1030448765 7:109682062-109682084 ATCTAATACATAGCCAAGTTTGG + Intergenic
1045916672 8:107480391-107480413 ATCAAATTCATGGTGAAGTTTGG + Intronic
1046444598 8:114301057-114301079 ATCAAATACATGCACAATTTGGG - Intergenic
1046540196 8:115570770-115570792 ATCAATTTCATGGCAATGTTGGG - Intronic
1050793370 9:9503905-9503927 AGCAACTACATGTCCAACCTTGG + Intronic
1052386473 9:27829185-27829207 ACCGACTACATGACAAAGTTCGG + Intergenic
1058377361 9:104338942-104338964 ATCTACTACACAGCCAAATTAGG - Intergenic
1058630229 9:106979005-106979027 ATCAAGGAGATGGCCAAATTGGG - Intronic
1203359044 Un_KI270442v1:195030-195052 TCCAACTACATGGTCAATTTTGG - Intergenic
1203373965 Un_KI270442v1:347245-347267 TCCAACTACATGGTCAATTTTGG + Intergenic
1188812566 X:34669399-34669421 TTCAACCTCCTGGCCAAGTTTGG - Intergenic
1189684249 X:43547378-43547400 ATCAAATTCATGGCAAAGCTTGG - Intergenic
1193115943 X:77775390-77775412 AACAATCACATGGCCAGGTTTGG + Intronic
1195428194 X:104759370-104759392 ATCTACTACTTGGACAATTTGGG + Intronic
1200297289 X:154933361-154933383 ATAAGCTATCTGGCCAAGTTGGG + Intronic