ID: 1070147556

View in Genome Browser
Species Human (GRCh38)
Location 10:73785836-73785858
Sequence CGGATCCGCGGGGGGGGACC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 80}

Found 15 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070147527_1070147556 18 Left 1070147527 10:73785795-73785817 CCCCGGGCCTCCCCTCAACCCCC 0: 1
1: 2
2: 3
3: 50
4: 612
Right 1070147556 10:73785836-73785858 CGGATCCGCGGGGGGGGACCCGG 0: 1
1: 0
2: 0
3: 8
4: 80
1070147539_1070147556 -1 Left 1070147539 10:73785814-73785836 CCCCGGCCGGCGGCCCAGGCCCC 0: 1
1: 6
2: 8
3: 46
4: 539
Right 1070147556 10:73785836-73785858 CGGATCCGCGGGGGGGGACCCGG 0: 1
1: 0
2: 0
3: 8
4: 80
1070147538_1070147556 0 Left 1070147538 10:73785813-73785835 CCCCCGGCCGGCGGCCCAGGCCC 0: 1
1: 3
2: 1
3: 54
4: 446
Right 1070147556 10:73785836-73785858 CGGATCCGCGGGGGGGGACCCGG 0: 1
1: 0
2: 0
3: 8
4: 80
1070147528_1070147556 17 Left 1070147528 10:73785796-73785818 CCCGGGCCTCCCCTCAACCCCCG 0: 1
1: 0
2: 5
3: 56
4: 537
Right 1070147556 10:73785836-73785858 CGGATCCGCGGGGGGGGACCCGG 0: 1
1: 0
2: 0
3: 8
4: 80
1070147535_1070147556 7 Left 1070147535 10:73785806-73785828 CCCTCAACCCCCGGCCGGCGGCC 0: 1
1: 0
2: 0
3: 10
4: 154
Right 1070147556 10:73785836-73785858 CGGATCCGCGGGGGGGGACCCGG 0: 1
1: 0
2: 0
3: 8
4: 80
1070147526_1070147556 25 Left 1070147526 10:73785788-73785810 CCTCAGGCCCCGGGCCTCCCCTC 0: 1
1: 0
2: 4
3: 94
4: 886
Right 1070147556 10:73785836-73785858 CGGATCCGCGGGGGGGGACCCGG 0: 1
1: 0
2: 0
3: 8
4: 80
1070147525_1070147556 26 Left 1070147525 10:73785787-73785809 CCCTCAGGCCCCGGGCCTCCCCT 0: 1
1: 0
2: 1
3: 52
4: 482
Right 1070147556 10:73785836-73785858 CGGATCCGCGGGGGGGGACCCGG 0: 1
1: 0
2: 0
3: 8
4: 80
1070147540_1070147556 -2 Left 1070147540 10:73785815-73785837 CCCGGCCGGCGGCCCAGGCCCCG 0: 1
1: 0
2: 11
3: 57
4: 560
Right 1070147556 10:73785836-73785858 CGGATCCGCGGGGGGGGACCCGG 0: 1
1: 0
2: 0
3: 8
4: 80
1070147524_1070147556 27 Left 1070147524 10:73785786-73785808 CCCCTCAGGCCCCGGGCCTCCCC 0: 1
1: 0
2: 3
3: 49
4: 674
Right 1070147556 10:73785836-73785858 CGGATCCGCGGGGGGGGACCCGG 0: 1
1: 0
2: 0
3: 8
4: 80
1070147529_1070147556 16 Left 1070147529 10:73785797-73785819 CCGGGCCTCCCCTCAACCCCCGG 0: 1
1: 0
2: 3
3: 66
4: 575
Right 1070147556 10:73785836-73785858 CGGATCCGCGGGGGGGGACCCGG 0: 1
1: 0
2: 0
3: 8
4: 80
1070147543_1070147556 -7 Left 1070147543 10:73785820-73785842 CCGGCGGCCCAGGCCCCGGATCC 0: 1
1: 0
2: 1
3: 50
4: 529
Right 1070147556 10:73785836-73785858 CGGATCCGCGGGGGGGGACCCGG 0: 1
1: 0
2: 0
3: 8
4: 80
1070147534_1070147556 8 Left 1070147534 10:73785805-73785827 CCCCTCAACCCCCGGCCGGCGGC 0: 1
1: 0
2: 0
3: 14
4: 176
Right 1070147556 10:73785836-73785858 CGGATCCGCGGGGGGGGACCCGG 0: 1
1: 0
2: 0
3: 8
4: 80
1070147532_1070147556 11 Left 1070147532 10:73785802-73785824 CCTCCCCTCAACCCCCGGCCGGC 0: 1
1: 0
2: 3
3: 64
4: 599
Right 1070147556 10:73785836-73785858 CGGATCCGCGGGGGGGGACCCGG 0: 1
1: 0
2: 0
3: 8
4: 80
1070147536_1070147556 6 Left 1070147536 10:73785807-73785829 CCTCAACCCCCGGCCGGCGGCCC 0: 1
1: 0
2: 1
3: 41
4: 399
Right 1070147556 10:73785836-73785858 CGGATCCGCGGGGGGGGACCCGG 0: 1
1: 0
2: 0
3: 8
4: 80
1070147541_1070147556 -3 Left 1070147541 10:73785816-73785838 CCGGCCGGCGGCCCAGGCCCCGG 0: 1
1: 0
2: 7
3: 89
4: 661
Right 1070147556 10:73785836-73785858 CGGATCCGCGGGGGGGGACCCGG 0: 1
1: 0
2: 0
3: 8
4: 80

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070147556 Original CRISPR CGGATCCGCGGGGGGGGACC CGG Exonic
900179077 1:1303490-1303512 CGGCTCGGCTGGGAGGGACCAGG + Intronic
900427314 1:2586622-2586644 CGAATCCGAGGGGGCGGAGCAGG + Intronic
901602149 1:10430673-10430695 CGCAGCCGCGGGGGGCGCCCGGG - Intronic
905630458 1:39515385-39515407 CGCATCCGCGCGGGGGGCGCCGG + Intronic
905667303 1:39770804-39770826 CGCATCCGCGCGGGGGGCGCCGG - Exonic
911601193 1:99849998-99850020 CGGCTCCGGGCCGGGGGACCTGG - Intergenic
923631256 1:235650303-235650325 GGGATCTGCGGGGCGGGGCCGGG + Intronic
924651708 1:245934605-245934627 CAGAACAGCGGGAGGGGACCAGG + Intronic
1064764762 10:18659564-18659586 CCGCGCCGCGGTGGGGGACCCGG + Exonic
1065802688 10:29366611-29366633 GGGATCCGCTGGTGGGGACGTGG + Intergenic
1070147556 10:73785836-73785858 CGGATCCGCGGGGGGGGACCCGG + Exonic
1074782175 10:116809937-116809959 AGGATCCCTGGGGAGGGACCCGG + Intergenic
1077224723 11:1435001-1435023 CCGAGGCGCGGAGGGGGACCGGG + Intronic
1080628527 11:34052177-34052199 CGGCTCCGCGGGGGAGGGGCGGG + Intronic
1083581245 11:63826924-63826946 CGGAGCCCCGGAGGGGGAGCTGG - Exonic
1083659827 11:64246858-64246880 CGGATCGGCGGGGAGGGGGCGGG - Exonic
1095349203 12:41188915-41188937 TGGGGCCGCGGGCGGGGACCCGG + Exonic
1099890242 12:88580769-88580791 CGGATCCGCTGGGGCTCACCTGG + Intronic
1101150294 12:101877455-101877477 CGGAGCCGCCGGAGGGGACGCGG - Exonic
1103048834 12:117761422-117761444 CGGATCCACGGGGTGGGCTCCGG + Exonic
1104961477 12:132490325-132490347 CGCATCGGCGGGGGCGGGCCCGG - Exonic
1113861488 13:113490434-113490456 CGGAGCCGCGAGGGACGACCGGG - Intronic
1117119390 14:52552322-52552344 GGGACCTGCGGGCGGGGACCTGG + Exonic
1118024074 14:61751197-61751219 CGGGGCCGCGGGCGGGGCCCGGG - Intergenic
1118137409 14:63045210-63045232 AGGATCCGCGGCGGGGGAGGGGG + Exonic
1118748675 14:68791542-68791564 AGGATCAGCAGGGGGGGACCGGG + Intronic
1123004604 14:105315142-105315164 CGGGGGCGCGGGGGGCGACCTGG - Exonic
1138252108 16:55509331-55509353 CGGCTCCGCGAGGCGGGTCCAGG + Exonic
1142193303 16:88727717-88727739 CGGGTCAACGGGTGGGGACCGGG - Intronic
1142292915 16:89201062-89201084 CGGACCCGCGGAGAGGGGCCGGG - Intronic
1143538693 17:7557258-7557280 CGGATCCGCAGGGAGGACCCTGG - Exonic
1146322749 17:31859256-31859278 CGGATCCTCGGGCGGGCAGCCGG - Exonic
1159586750 18:70289290-70289312 CGGGTGCGCGGGCGGGGGCCAGG + Intronic
1160659634 19:291866-291888 CGGAGCCCCGGGCGGGGACGTGG + Intergenic
1161196093 19:2987490-2987512 CGGGTCCCCCGGGGGGGACTTGG + Intronic
1161210264 19:3062132-3062154 CGGATCCGGGGTGGGGGCGCCGG + Intronic
1162019930 19:7863735-7863757 CGCAGCCGCGGGGGGCGCCCGGG + Intronic
1167463853 19:49640040-49640062 CGGCCCCGGGGCGGGGGACCTGG - Exonic
1168588569 19:57614430-57614452 CGGAGCCGCGAGGGGGTCCCAGG - Exonic
945241534 2:207681383-207681405 CGGATCCGCGGGGAGGGGGCGGG + Intergenic
1169230994 20:3889005-3889027 CGGAGCAGCGGGGTGGGACTCGG + Intronic
1173251617 20:41366724-41366746 GGGACCCTCGGGGCGGGACCCGG - Exonic
1173852406 20:46227460-46227482 CGGAGCCGTGGGGCGGGGCCAGG - Intronic
1175951435 20:62585630-62585652 CGGACACGCGCGGGGGGACGGGG + Intergenic
1175953543 20:62596464-62596486 CGTATCCTGGTGGGGGGACCCGG + Intergenic
1180949374 22:19714367-19714389 CGGGTCCATGGTGGGGGACCTGG + Intergenic
1181026741 22:20131522-20131544 CGGCTCCGCGGCCCGGGACCAGG + Intronic
1181162088 22:20965244-20965266 CGGGGCGGCGGGCGGGGACCGGG - Intronic
1182576454 22:31276498-31276520 CGGATCGGCGGGGAGGGGGCGGG + Intronic
950282366 3:11719379-11719401 CCGGTCGGCGGGGCGGGACCCGG - Intronic
961305644 3:125958127-125958149 CGTATCAGCGGGGGCGGGCCCGG - Intergenic
961482485 3:127193048-127193070 CGCAGCCGCGGGGCGGGGCCTGG - Intergenic
967152761 3:186664852-186664874 GGGATCAGCAGGGGGGGACTGGG - Intronic
968450552 4:674146-674168 CGGAGCTGCGGGGCGGGACACGG + Intronic
969476035 4:7422896-7422918 CGGATCCCCGCGGGGTGCCCTGG - Intronic
969714300 4:8860990-8861012 CGGAACCGCGGGGAGGGGGCGGG + Intronic
984888850 4:184473852-184473874 CGGATCCGAAGGAGGGGAGCGGG - Intronic
984973376 4:185209763-185209785 CGGAGCGCCGGCGGGGGACCGGG + Intronic
986747965 5:10760920-10760942 GGGCTCCGCGGGGAGGGCCCCGG - Intronic
1003084961 6:3053693-3053715 CGGCTCCGCCCTGGGGGACCAGG + Intergenic
1003290456 6:4775648-4775670 GGGATCCGGGGGGCGGGAGCCGG - Intronic
1006671464 6:35732039-35732061 CGGATGCGCGCGGGGGGAGGAGG + Intergenic
1006770301 6:36547422-36547444 CGTCTCCGCGGCGGGGGACCGGG - Exonic
1007596440 6:43053814-43053836 CGGAGCCGCTGGCAGGGACCGGG - Exonic
1011277439 6:85643763-85643785 CGGAGCCGGGGGCGGGGGCCGGG - Intronic
1017899286 6:158705556-158705578 TAGAGCAGCGGGGGGGGACCTGG + Intronic
1021685557 7:23182247-23182269 AGGGTCCGCCGGCGGGGACCGGG + Intronic
1023016390 7:35971752-35971774 CGGATCGGCGGGGAGGGAGCGGG - Intergenic
1023773739 7:43583484-43583506 CGGACGCGCGGGGCGGGACGTGG + Intronic
1023842438 7:44104843-44104865 CGGACCCGCGGGGTGGGCTCGGG - Exonic
1024578420 7:50782771-50782793 CGGCTCCGCGGAGGGGCCCCCGG - Intronic
1024811654 7:53219215-53219237 CGGAGCTGCGGGGCGGGACTGGG + Intergenic
1026665543 7:72337184-72337206 GGGATCCGCTGGGGAGGAGCTGG - Intronic
1027654981 7:80919233-80919255 GGGAGCCGCGGGGGCGGACCGGG + Exonic
1031401290 7:121328844-121328866 CGGCTCCGCGGGGGGCGCTCCGG - Intronic
1038633002 8:29263124-29263146 CGGAGCCGGGGGTGGGGACCGGG + Intronic
1049557512 8:143290505-143290527 CGGAGGCGCGGGCAGGGACCTGG + Intronic
1049747554 8:144269393-144269415 CGCACCCTCGGGGGGAGACCAGG + Intronic
1059115612 9:111598384-111598406 CGGTGCCGCGGGAGGGGACACGG + Intronic
1061822953 9:133238677-133238699 CGGAGCCGGTGGGCGGGACCCGG + Intergenic
1062472686 9:136713212-136713234 CGGGTCCGCAGGGGAGGCCCGGG + Intronic
1062542027 9:137045811-137045833 GGGATCGCCGGGCGGGGACCGGG - Intronic
1062659210 9:137619385-137619407 CGGATCTGCGGGGAGGGCCTCGG + Intronic
1062716254 9:138011669-138011691 CGGATCTGCGAGGAGGGACCTGG + Intronic
1203787629 EBV:136690-136712 CGGGCCCGCGGGCGGGGACCCGG + Intergenic
1203361375 Un_KI270442v1:221004-221026 AGGATCCGCGGGTGGGGAGGGGG + Intergenic
1186410780 X:9342828-9342850 GAGATCCCCGGGGGAGGACCCGG - Intergenic
1188338059 X:28962813-28962835 GGTATCCGTGGGGGGGGTCCTGG + Intronic
1189002873 X:36963964-36963986 GGGAGCCGCGGGCGGGGGCCTGG - Intergenic