ID: 1070147673

View in Genome Browser
Species Human (GRCh38)
Location 10:73786354-73786376
Sequence GCGCGTGCGCGCGCTGTGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 66
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 61}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070147671_1070147673 23 Left 1070147671 10:73786308-73786330 CCACACCTGTGTGTGTGTGGGTG 0: 1
1: 6
2: 74
3: 533
4: 2687
Right 1070147673 10:73786354-73786376 GCGCGTGCGCGCGCTGTGACAGG 0: 1
1: 0
2: 0
3: 4
4: 61
1070147672_1070147673 18 Left 1070147672 10:73786313-73786335 CCTGTGTGTGTGTGGGTGTGTGT 0: 5
1: 1542
2: 2673
3: 4047
4: 6439
Right 1070147673 10:73786354-73786376 GCGCGTGCGCGCGCTGTGACAGG 0: 1
1: 0
2: 0
3: 4
4: 61

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070147673 Original CRISPR GCGCGTGCGCGCGCTGTGAC AGG Intronic
905670552 1:39788072-39788094 GCGCATCCGCGGGCTGTGCCGGG - Intronic
914869120 1:151458811-151458833 GCGCGCGCGCGCGCCGCGGCGGG + Intronic
917974790 1:180231547-180231569 GCGCGCGCGCGCGCGACGACTGG - Intronic
1070147673 10:73786354-73786376 GCGCGTGCGCGCGCTGTGACAGG + Intronic
1076354795 10:129843854-129843876 GAGAGTGTGCGCGCTGTGCCTGG + Intronic
1077036503 11:498008-498030 GGGCGTGCGGGAGCTGTGCCAGG - Exonic
1085029898 11:73264654-73264676 GGGCGTGCGCGGGCAGGGACAGG + Intronic
1088606842 11:111540929-111540951 GTGAGTGCGCGCGCTGGGGCGGG + Intronic
1089557230 11:119321170-119321192 GCGCGGGCTCGCGCTGGGTCGGG - Intronic
1092204695 12:6607586-6607608 GCGCGCGCGCCCGCTGCGAAGGG - Intergenic
1097019148 12:56007699-56007721 GCGCGCGCGCAGGCTGTGAGGGG - Exonic
1097232433 12:57520831-57520853 GCGCGTGCGCGTGCAGACACCGG - Intronic
1105006978 12:132727619-132727641 GCGCGTGTGCCCGCGGTGCCAGG - Intronic
1113517387 13:110914378-110914400 GCGCGCGCGCGCGCTCGCACAGG + Intronic
1118404818 14:65412796-65412818 GCGCGTGCGCGCGTTATCTCCGG + Intronic
1121168849 14:91836422-91836444 GCGCGGCCGCGCGAGGTGACCGG - Intronic
1122905717 14:104800656-104800678 GCGCGCGCGCGAGCGGCGACCGG + Intronic
1127906740 15:63381738-63381760 GGGCGGGCGCGGGCTGTGCCGGG + Exonic
1129983550 15:79896714-79896736 GGGCGTGCGCGCGCCGGGAGGGG + Intronic
1134131027 16:11650369-11650391 GCGCGCGCGCGCGCTGTCCATGG - Intergenic
1138281367 16:55774356-55774378 GCACATGCGCGTGCTGTGGCAGG + Intergenic
1141694456 16:85613091-85613113 GCGCGCGCGCGCGCACCGACGGG - Intronic
1146033919 17:29390225-29390247 GCGCGCGCGCGCGCCCTCACAGG - Intergenic
1152356752 17:79811276-79811298 GCGCGTGCGCGCGCCTCGGCGGG - Intergenic
1152417680 17:80173330-80173352 GCGCGCGCGCGCGGAATGACAGG + Intronic
1158991641 18:62874630-62874652 GTGCGTGCGCGCCCTGTGATGGG - Intronic
1160696872 19:489140-489162 GTGGGTGCGCGCGCAGTGGCAGG + Intergenic
1161707249 19:5827909-5827931 GCGCGTGAGCGAGCTGGGCCTGG + Exonic
1162742690 19:12782653-12782675 GCGCGTGCGTGGGCGGTGGCGGG + Intronic
1166751949 19:45168442-45168464 GCCCGTGTGCGCCCTGTGATGGG - Intronic
926020186 2:9487838-9487860 GCGCGCGCGCGCGCTGTGGGGGG + Intronic
928278300 2:29921621-29921643 GCGCGAGCGCGCGCAGGGAGGGG + Intergenic
930411169 2:51027914-51027936 GCGGATGCGCACGCTGTGCCAGG + Exonic
934487982 2:94735807-94735829 GCGCGTGGTGGCGCTGTGTCTGG - Intergenic
942046637 2:172102783-172102805 GCGCGAGCGCGGGCTCTGGCGGG + Exonic
947693901 2:232166342-232166364 GTGCGCGCGCGCCCTGTGAAAGG + Intronic
948645585 2:239401694-239401716 GCGCCTGCGCACTCAGTGACCGG - Intronic
1169405084 20:5315894-5315916 GCGCGCGCCCGGGCTGGGACAGG + Intergenic
1175859795 20:62143931-62143953 GGGCGGGCGCGCGCGGGGACGGG + Intronic
1184726824 22:46351945-46351967 TCGTGTGCGCCGGCTGTGACTGG + Intronic
951558861 3:23946031-23946053 GCGCGCGCGCGCGCGCTGGCTGG + Intronic
978620337 4:110630664-110630686 GCGCCTGCGCGGCTTGTGACTGG + Intronic
981061275 4:140427653-140427675 GCGCGTGCGCGTGCGGTGGCGGG + Exonic
985339845 4:188938926-188938948 GCCCGGGCTCTCGCTGTGACTGG - Intergenic
985959390 5:3288463-3288485 GCGAGAGCGCGCGCTGACACAGG + Intergenic
993901162 5:93584945-93584967 GCGCGCGGGCGCGCTGGGAGGGG - Exonic
999239131 5:150117521-150117543 GCGCGCGCGCGCGCGCTGCCAGG - Intronic
1014137631 6:117907511-117907533 GAGGGTGCGCGCACTGGGACTGG + Exonic
1015842258 6:137488492-137488514 GCGCGTGAGGGCGCTGGGACCGG + Intergenic
1018400153 6:163414032-163414054 GCGCGTGCGCGCGTCGAGCCCGG - Intronic
1027001740 7:74658509-74658531 GCGGGGGCGCGCGCGGTGCCAGG + Intronic
1034659840 7:152759692-152759714 GGGCGTGCGCGCGTTCTGATTGG + Intergenic
1037835436 8:22212507-22212529 GTGTGTGTGCGCGCTGTGATGGG - Intergenic
1037900480 8:22685431-22685453 GCGCGCGCGCGCGCGGGGAGGGG + Intergenic
1038767911 8:30446845-30446867 GCGCGCGCGCGCGCGGTGGAGGG + Intronic
1040495213 8:47960146-47960168 GCGCGTGCGCCCGCTCGGCCCGG + Exonic
1049182588 8:141230638-141230660 GCCCGAGCGCACGCTGTGTCTGG + Intronic
1053919613 9:42974867-42974889 GCGCGTGGTGGCGCTGTGTCTGG + Intergenic
1056755111 9:89376866-89376888 GGGCGTGCACGTGCTGTGCCTGG + Exonic
1060584459 9:124777404-124777426 GCGCGAGGGGGCGCTGTGGCTGG + Intronic
1061880980 9:133568709-133568731 GCACGGGCCCGCCCTGTGACCGG + Exonic
1062567463 9:137169709-137169731 GCGCCTGCGCGCGCTGCTGCTGG - Exonic
1186849944 X:13570046-13570068 GTGCCTGTGCGCGCTGCGACGGG + Intronic
1187389011 X:18873684-18873706 TCGCGTGAGGGAGCTGTGACTGG - Intergenic
1187868284 X:23743308-23743330 GGGCGTGGCCGCGCTGTGCCGGG + Intronic
1200068878 X:153518118-153518140 GCGCGTGCGCGCGCGATGCGGGG - Intronic