ID: 1070150818

View in Genome Browser
Species Human (GRCh38)
Location 10:73803806-73803828
Sequence AAGTCTGTGCTGAGGGAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 308
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 286}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070150818 Original CRISPR AAGTCTGTGCTGAGGGAAGC TGG Intronic
901302940 1:8212778-8212800 AAGTGTTTGCTCAGGGGAGCGGG + Intergenic
901431032 1:9215121-9215143 AAGTCTGTGATTAGGGAAAGTGG + Intergenic
902112964 1:14098600-14098622 CAGTCTGGGCAGAGGGATGCTGG - Intergenic
902410754 1:16210254-16210276 AACCCTGTGGTGAGGCAAGCAGG + Intronic
903654101 1:24938451-24938473 AAGTTTGTGCAGAGGCAACCGGG - Intronic
904207809 1:28866003-28866025 AAATCTGTCCTGAGGTCAGCAGG + Intergenic
904734872 1:32624021-32624043 AAGTGAGTGCTGAGCGAAGGGGG - Intronic
905670317 1:39786954-39786976 GAGTCTGGGCTGAGGAAAACAGG - Intronic
905874885 1:41426375-41426397 AAGTGTCTGCTGTGGGAACCCGG + Intergenic
907920254 1:58904910-58904932 GAGTCTTTGCTGAGGCAGGCAGG - Intergenic
912092014 1:106090008-106090030 AAGGTTGTGCTGGAGGAAGCTGG - Intergenic
914915877 1:151818915-151818937 AAGTCTGGCCTGAGGGATGATGG - Intronic
915328456 1:155093475-155093497 ATGTCTGTGGTGTGGGAAGAGGG - Intergenic
918170316 1:181990056-181990078 TAGTATGTGCTGAGGGGAGTGGG + Intergenic
918311296 1:183287406-183287428 GTGTTTGTGCTGCGGGAAGCAGG + Intronic
921559804 1:216643742-216643764 GATTCTGTTCTGAGGGAACCAGG - Intronic
923540096 1:234882609-234882631 AGGTCTGTGCTGAGGGCTGAAGG - Intergenic
924852626 1:247845630-247845652 AAGGCTGCACTGAGGGAGGCTGG - Intergenic
1069752297 10:70752302-70752324 AACCCAGTGCTGAGGGGAGCAGG - Intronic
1069780783 10:70954103-70954125 ATGGATGTGCTGAGGGAAGAAGG - Intergenic
1070150818 10:73803806-73803828 AAGTCTGTGCTGAGGGAAGCTGG + Intronic
1070476830 10:76837006-76837028 AAGTCAGTGCAGAAGAAAGCAGG + Intergenic
1072790819 10:98316429-98316451 CAGGCTGAGCTGAGGGAAGCAGG + Intergenic
1073070947 10:100792965-100792987 AAGTCTTTGGTGCGGAAAGCAGG - Intronic
1073605919 10:104895544-104895566 GAGTGTGAGCTGAGGGATGCTGG - Intronic
1074121057 10:110494910-110494932 AGGTCTGGGGTGAGGGTAGCAGG - Intergenic
1074184754 10:111091092-111091114 AAGGCTGTGATGAGAGAAGATGG + Intergenic
1074290347 10:112133511-112133533 TCGTCTGTGCTGGGGGAAGAAGG - Intergenic
1075307037 10:121377435-121377457 AAGGCTCTGCTGACGGAAGGGGG - Intergenic
1075988003 10:126804808-126804830 ACGTGTGGGCTGAGGGAAGGAGG - Intergenic
1075997400 10:126889630-126889652 AATTCTGTTCTGAGAGAAGGAGG - Intergenic
1076153258 10:128181110-128181132 GACACTGTGCTGAGTGAAGCCGG - Intergenic
1076649918 10:131980914-131980936 GAGCCTTTGCTCAGGGAAGCGGG - Intronic
1077285927 11:1765947-1765969 AAGTCTGGGCTAAGGGAGGAGGG - Intergenic
1079134713 11:17769997-17770019 CATTCTGTGTTGAGGGAAGCTGG - Intronic
1080636697 11:34130691-34130713 AAGGCTGTCCTGGGGGAAGCAGG + Intronic
1081613501 11:44577380-44577402 AAGTCTTCCCTGAGGGAAGAAGG - Intronic
1081626596 11:44659685-44659707 AAGTCTCTGCTGCGGGGAGGAGG + Intergenic
1083396839 11:62398349-62398371 AAGGCTGAGGTGAGGGGAGCTGG - Intergenic
1083428041 11:62599351-62599373 AACCCTGTGCTGAGGCAAGGGGG + Intronic
1083628241 11:64082801-64082823 ATGTCTGAGCTGAGGGAAACAGG - Intronic
1084351472 11:68603051-68603073 AAGTGTCTGCTGGGAGAAGCTGG + Intronic
1084712386 11:70852057-70852079 CACTCTGTGCCCAGGGAAGCAGG + Intronic
1084967398 11:72751814-72751836 AAGTATGTGCTCAGGGAATGGGG - Intronic
1085267659 11:75246775-75246797 GTGACAGTGCTGAGGGAAGCAGG - Intergenic
1085812415 11:79696089-79696111 AATTCTGTGCTAAGGGAAAAAGG - Intergenic
1086700179 11:89892783-89892805 AAGTCTGTGCTGGGGTAGGTAGG - Intergenic
1086705991 11:89951733-89951755 AAGTCTGTGCTGGGGTAGGTAGG + Intergenic
1087798973 11:102483603-102483625 TAGTCTGTGGTGAAGGAAGAGGG - Intronic
1089596868 11:119585991-119586013 CAGTCAGTTCTAAGGGAAGCTGG - Intergenic
1090356907 11:126146560-126146582 AGGTCTGTGCAGAGGGATGAGGG - Intergenic
1091408041 12:221122-221144 ATGTTGGTGATGAGGGAAGCTGG - Intronic
1092793897 12:12092139-12092161 AAGTCCCTGCTTAGGGAAGCTGG - Intronic
1093215942 12:16361324-16361346 AATTCTGATCTGAGGGAAGGAGG + Intronic
1095740019 12:45596763-45596785 AAGCCTGTTCTGAGGAAAACTGG - Intergenic
1095978353 12:47955173-47955195 AAGTATATGCTAAGGGAGGCTGG - Intergenic
1096504605 12:52084832-52084854 AAGTCTGTGGTGGGGATAGCAGG + Intergenic
1097174560 12:57135361-57135383 AAGGCTCTGCTGAGGGGAGTGGG + Intronic
1098420732 12:70294297-70294319 AAGTATGTGGTGGGGAAAGCCGG + Intronic
1102986520 12:117282943-117282965 TACACTGTGCTGAGGGAAGCAGG - Intronic
1104269682 12:127271991-127272013 TAGGCAGTGTTGAGGGAAGCAGG - Intergenic
1104309333 12:127640256-127640278 AATTTTGTGCTGAGAGTAGCTGG + Intergenic
1104414807 12:128589340-128589362 AGGTCTGGGCGGAGGGATGCAGG - Intronic
1105024993 12:132842250-132842272 CAGTCTGTGGAGAGGGAAGGTGG - Intronic
1105282146 13:18972034-18972056 GACTCTGTTCTGAGAGAAGCAGG - Intergenic
1105595627 13:21834961-21834983 AAGTCTGCCCTGTGGGGAGCTGG - Intergenic
1105786789 13:23758081-23758103 AAGTGAGTGCTAAGCGAAGCAGG + Intronic
1106234497 13:27850738-27850760 ACCACTGTGCTGAGGGAAGCAGG + Intergenic
1109204303 13:59464936-59464958 AAGTCTGTGGACAGGGAAGAGGG + Intergenic
1109686815 13:65831060-65831082 AAGGATGTGATGAGGGAAGCAGG - Intergenic
1110473521 13:75887273-75887295 AAGTCTGTGGTGAGGGAGGAGGG + Intergenic
1112926371 13:104679887-104679909 AAGTCTATTCTGATGGAATCAGG - Intergenic
1113226591 13:108166759-108166781 AAGTCAGTGCCGTGGGATGCAGG - Intergenic
1117520739 14:56549102-56549124 AGGACTGTGCTGAGGGAATTGGG - Intronic
1118284151 14:64455816-64455838 CAGTGTGAGCTGAGGGCAGCAGG - Intronic
1118298241 14:64590343-64590365 CAGTCAGTTCTGAGGGCAGCAGG + Intergenic
1119154075 14:72392464-72392486 ATGTCTGTGATGATGGGAGCCGG - Intronic
1119264398 14:73255460-73255482 GACTGTGTGCTGAGGGAAGGAGG + Intronic
1120146029 14:80979354-80979376 AAGGCTGTGCAGAGGGTAGGGGG + Intronic
1121668749 14:95692114-95692136 AGGTCTGTACTTAGGGCAGCTGG + Exonic
1122328060 14:100894575-100894597 TACTGTGTGCTGAGGGAAGATGG - Intergenic
1123010850 14:105348890-105348912 AAGTGGGTGCTGAGTGCAGCAGG - Intronic
1123022386 14:105406972-105406994 AAAGCTGTGCTGCGAGAAGCTGG - Intronic
1127256330 15:57296763-57296785 AAGCCTGTGCTGAAAGGAGCGGG + Intronic
1128248938 15:66151629-66151651 AAGTCTTTGCTCTAGGAAGCAGG - Intronic
1128254687 15:66188031-66188053 AATTCTGTGCTGGGGGGAGCCGG + Intronic
1128729518 15:70011311-70011333 CAGTCTGTGCTGCAAGAAGCAGG + Intergenic
1129175548 15:73837498-73837520 GAGTCTATGCTGAGGGAAGCTGG + Intergenic
1129324982 15:74795047-74795069 AAGCCGATGGTGAGGGAAGCGGG - Intronic
1129525440 15:76210829-76210851 CACTCTTTGCTCAGGGAAGCAGG - Intronic
1129790150 15:78335704-78335726 AGGTGAGTGCTGAAGGAAGCAGG - Intergenic
1129913479 15:79247300-79247322 GAGTGTGTGCTCAGGGAAGGAGG - Intergenic
1131462591 15:92629090-92629112 AAGGCTGTGCTGAGGAACACAGG + Intronic
1133450993 16:5903909-5903931 CTGTCTTTGCTGAGGGAAGCTGG + Intergenic
1133712991 16:8419565-8419587 AATTGTGTGTTGAGGGAAGAGGG - Intergenic
1134058072 16:11182593-11182615 CAGGCTGGGCCGAGGGAAGCAGG + Intergenic
1134147334 16:11776443-11776465 ATGTCAGAGCTGAGGTAAGCTGG - Exonic
1135355064 16:21762154-21762176 AAGTCAGGGCTCAGGGAAGGGGG + Intergenic
1135453548 16:22578296-22578318 AAGTCAGGGCTCAGGGAAGGGGG + Intergenic
1138537108 16:57666112-57666134 AAGCCTGTAAGGAGGGAAGCTGG - Intergenic
1138737375 16:59266020-59266042 AAGTCTGAACTAAGGGTAGCAGG - Intergenic
1140249158 16:73279768-73279790 GACTCTGTTCTGAGAGAAGCAGG - Intergenic
1140479044 16:75252694-75252716 AATTCTCTGCTGCGTGAAGCCGG - Intronic
1142899737 17:3004538-3004560 ACCTCTGTGCAGAGGGAAGGCGG + Intronic
1142978084 17:3656967-3656989 AAGTCTGGGGTGAGGGACTCAGG + Intronic
1143870444 17:9954304-9954326 AGGTCTGTCCTGAAGGCAGCAGG + Intronic
1143977235 17:10838816-10838838 CAGACTGTGCTTCGGGAAGCTGG + Intergenic
1144373587 17:14617162-14617184 AAGTCTGTGTTGGGGTAAACTGG - Intergenic
1146651901 17:34612304-34612326 AATTCGGGGCTGAGGAAAGCAGG + Intronic
1147034118 17:37667349-37667371 AAGTCTGTGGGGAAGGAACCAGG + Intergenic
1150580983 17:66473501-66473523 AAGGCTGTTCTGAGGGACTCTGG - Intronic
1152134275 17:78494768-78494790 AAGTCTGTGCTGGTGGTGGCCGG - Exonic
1152233305 17:79125628-79125650 AGGGCTGTGCCGAGGGAAGGCGG - Intronic
1152523689 17:80875451-80875473 CAGTGTGTGGTGAGGGAAGGGGG + Intronic
1152633124 17:81419585-81419607 AAGCCAGTGCCGAGGGAAGAGGG + Intronic
1153993790 18:10422706-10422728 AGGGATGTGTTGAGGGAAGCTGG - Intergenic
1156264110 18:35470456-35470478 AAGTCTCTTCTGAGGGATCCTGG + Intronic
1157085069 18:44572093-44572115 GAGTCTTTGCTGAGAAAAGCAGG - Intergenic
1157546567 18:48550623-48550645 CAGACTGTGCTGTGGGAAGAGGG - Intronic
1157550104 18:48575565-48575587 AAGCCTGTGCTGGGGGTTGCAGG - Intronic
1157584428 18:48792092-48792114 AAGGCTGTGGAGAAGGAAGCAGG + Intronic
1160854279 19:1209219-1209241 GAGCCTGTGCTGGGGGTAGCAGG + Intronic
1160908090 19:1461088-1461110 AAGAAGGTGCTGAGGGAGGCGGG + Exonic
1161032226 19:2062758-2062780 AGGTCTCTCCTGAGAGAAGCAGG - Intergenic
1162020268 19:7865040-7865062 AAAACCGTGCTGAGGGAAGGTGG + Intergenic
1162926743 19:13934022-13934044 GAGTCTGGGATGAGGGCAGCGGG + Intronic
1165374398 19:35431516-35431538 TAATCTGTGCTGGGGGCAGCAGG - Intergenic
1165667458 19:37645298-37645320 AAGCCTGTGATGTGGGAAGGTGG + Intronic
1166336940 19:42114043-42114065 AGATCAGAGCTGAGGGAAGCTGG + Intronic
1167668821 19:50838409-50838431 TGGGCTGTGCTGGGGGAAGCTGG + Intergenic
1167959488 19:53094924-53094946 CAGCCTGGGCTGTGGGAAGCGGG - Intronic
924981230 2:223376-223398 GAGACAGAGCTGAGGGAAGCTGG - Intronic
925909966 2:8567380-8567402 AAGGCTGCGCTGGAGGAAGCTGG - Intergenic
927386651 2:22541962-22541984 AGGTCTTTTCTGGGGGAAGCTGG + Intergenic
927866141 2:26588777-26588799 GAGGCTGTGCTGATGGGAGCAGG + Intronic
927886524 2:26721811-26721833 ATGTTTGTCCTGAGGGAAGGTGG - Intronic
928294246 2:30069194-30069216 AAGTGTCTGATGAGGGAAGGAGG - Intergenic
928449407 2:31365267-31365289 AAGGTAGTGCTGAGGGAGGCTGG - Intronic
929559275 2:42945647-42945669 ACATCTGTGCTGAAGGGAGCTGG + Intergenic
929936802 2:46298972-46298994 GAGGCTATGCTGCGGGAAGCTGG + Intronic
930921899 2:56765998-56766020 AAATCAGTGCTGAGTGAAGGGGG - Intergenic
931196184 2:60054116-60054138 TGGTCTGTGGTGACGGAAGCTGG + Intergenic
931582349 2:63790636-63790658 AAGCCTTTGATGAGGGAAGAAGG + Intronic
932284871 2:70523709-70523731 AGGTCTGGGCTGAGAGAAGGAGG - Intronic
932421205 2:71602528-71602550 ATGTCAGTGCAGAGGGACGCTGG - Intronic
932708661 2:74046788-74046810 AAGTCTGTGGTCATGGAAGGAGG + Exonic
932828830 2:74968531-74968553 AATGCTTTGCTGTGGGAAGCTGG + Intronic
934715853 2:96542835-96542857 ATGTGTGAGCTGAGGGTAGCAGG + Intronic
935329595 2:101967130-101967152 AAGACTGTGGTGTGGGAGGCTGG + Intergenic
936047907 2:109201095-109201117 AGGTCTGTGCTGAGGGACAGGGG - Intronic
936067653 2:109344400-109344422 AAGTCTGTGCTTCTGGAACCTGG - Intronic
937087773 2:119182600-119182622 AAGTGTGTGTTGGGGGGAGCTGG - Intergenic
939631416 2:144530254-144530276 TTCTCTGTGTTGAGGGAAGCTGG + Intergenic
940220645 2:151347871-151347893 AAGTGAGTGCCGAGGGAAGGAGG + Intergenic
941155320 2:161970880-161970902 AAGTCTGTGCTGAGTAGAGGCGG - Intronic
943004658 2:182375270-182375292 AAGTCTTTTCTGAGACAAGCAGG + Intronic
943220853 2:185104272-185104294 GAGTCTGTCCTGAGAGATGCTGG + Intergenic
946028785 2:216689149-216689171 AGGACTGTGCTGTTGGAAGCGGG + Intronic
947584476 2:231345093-231345115 AAGTCAGGGCTAAAGGAAGCGGG + Exonic
947588843 2:231373093-231373115 CACTCTGTGCTCAGGGAAGAAGG + Intronic
1168803718 20:660901-660923 AAGTCTGAGTTGAGGGTAGGTGG + Intronic
1168830697 20:843900-843922 TATGCTGTGCTGAGAGAAGCTGG - Intronic
1169236064 20:3930866-3930888 AGGTCTGAGCTGAGGGATACAGG - Intronic
1169566866 20:6864079-6864101 AAGTCTGGGCTGAGTATAGCTGG + Intergenic
1169798206 20:9488164-9488186 AAGCCTGTGCTGAGTGAGGGAGG + Intergenic
1170591112 20:17772704-17772726 AGGTCCGTCTTGAGGGAAGCAGG + Intergenic
1171957775 20:31473118-31473140 AAGGCAGTGCTGTGGGCAGCAGG + Intronic
1171968586 20:31549193-31549215 AATCCAGTGCTGAGGAAAGCGGG - Exonic
1172784300 20:37456391-37456413 AAGCCTGTGCTGGGGCAAGGAGG - Intergenic
1172884567 20:38222536-38222558 GAGGCTGTGCTGAGGGACCCCGG - Exonic
1173290725 20:41712689-41712711 AGGACTGTGTTTAGGGAAGCAGG - Intergenic
1174334696 20:49851258-49851280 AAGCCTGTGGTGGGGGAAGCAGG + Intronic
1175202063 20:57284852-57284874 CAGTCTCTGGTGATGGAAGCAGG - Intergenic
1175313084 20:58025288-58025310 AGGACTGTGGTGAGGGAAGGGGG + Intergenic
1178454358 21:32733556-32733578 AAATGAGTGCTGAGGGAAGGGGG - Intergenic
1179297101 21:40072781-40072803 AAGTAAGTGCTGAGGGAAAGAGG - Intronic
1179442768 21:41407072-41407094 GAGGCTTTGCTGAGGGAAGGAGG + Intronic
1179894468 21:44353648-44353670 AGGACTGTCCTGAGGGCAGCAGG + Exonic
1180986214 22:19905417-19905439 AACCCTGTGCTGGGGGCAGCTGG - Intronic
1181386960 22:22553329-22553351 AAGGCTGTCCTGAAGGAAGGTGG + Intronic
1181616043 22:24055109-24055131 AGGACTGTGCAGTGGGAAGCTGG - Exonic
1181998974 22:26904589-26904611 AATTCTCCACTGAGGGAAGCAGG + Intergenic
1182299733 22:29330848-29330870 GAGGGTGTGCTTAGGGAAGCAGG - Intronic
1183265371 22:36821824-36821846 GAATCTGTGCTGATTGAAGCAGG + Intergenic
1184259093 22:43304470-43304492 AAGAGTGTGCTGTGAGAAGCAGG + Intronic
1184843512 22:47066537-47066559 AAGCGTGTGCGGAGGGAGGCTGG + Intronic
1184907333 22:47497756-47497778 AAGTAGGCCCTGAGGGAAGCCGG - Intergenic
1185164402 22:49251912-49251934 GAGTGTGAGCTGAGGGAAGGAGG + Intergenic
1185248765 22:49788436-49788458 ACTTCTGTGCTGTGGGGAGCGGG - Intronic
949508941 3:4751867-4751889 AAGTCAGTTCTCAGGGAAGCAGG - Intronic
950527936 3:13535589-13535611 AAGTCTCTCCGGAGGGATGCAGG + Intergenic
953063012 3:39443496-39443518 AAGTCTGAGATGAGGAAAACAGG + Intergenic
954080045 3:48208194-48208216 CAGACTCTGCTGAGAGAAGCTGG + Intergenic
954434383 3:50488308-50488330 ACGGCTGTGCCCAGGGAAGCTGG + Intronic
954898378 3:53996860-53996882 CAGTCACTGCTGAGGGACGCTGG - Intergenic
956191121 3:66609651-66609673 AAGCCTGAGCTGAAGAAAGCTGG - Intergenic
959100359 3:102002767-102002789 AAGTATGTACTGAGGGGAGGGGG - Intergenic
960694919 3:120386725-120386747 AGGTATGTGCTGAGGGCTGCTGG + Intergenic
962010208 3:131384215-131384237 AAGTTTGGGCAGAGGGAACCAGG + Intronic
962308364 3:134308686-134308708 AAGACTGTGCTGAAGCAAGGTGG - Intergenic
962944619 3:140155763-140155785 AAGTCTTTGACGAGGGAAGCTGG - Intronic
963710413 3:148740593-148740615 AAGTTTTTCCTGAGGTAAGCAGG - Intronic
964465000 3:156982260-156982282 AAGCCAGTGCTGAGGGCAGCAGG - Intronic
966157522 3:176933226-176933248 AACTCTGTTCTGAGGGTAACAGG - Intergenic
966920945 3:184610938-184610960 ATGTCTTAGCTGAGAGAAGCGGG - Intronic
966979580 3:185119354-185119376 AAATTTGTGCTAAGAGAAGCCGG + Intronic
968705344 4:2075002-2075024 AAGTCTGTGCTGAGCCTAGGGGG + Intronic
969539888 4:7781584-7781606 AAGCCTCTGCTGCAGGAAGCAGG + Exonic
969685555 4:8672148-8672170 AAGTCGGAGCTGAGGGCAGCAGG + Intergenic
971081131 4:23212609-23212631 AAGTGAGTGCTGAGTGAAGGAGG + Intergenic
971157350 4:24097269-24097291 AAGTCTGGGGTGAAGGGAGCAGG + Intergenic
972681467 4:41310639-41310661 AAGTGAGTGCTGAGTGAAGTGGG + Intergenic
972936965 4:44147999-44148021 AAGTCTGTCCTGAGGCCAGAGGG + Intergenic
973548403 4:52005756-52005778 AAGTAAGTGCTCAGGGCAGCAGG - Intronic
974146634 4:57955963-57955985 AAATTTGTGGTGAGGGAAGGGGG + Intergenic
974163159 4:58166219-58166241 AGGGCTGTGCTGAGGAAAACAGG - Intergenic
974245966 4:59318124-59318146 AAGTTTTTACTGAAGGAAGCTGG - Intergenic
977008505 4:91604062-91604084 AAGTATGTGATTAGGGAAGTGGG - Intergenic
977864199 4:102003435-102003457 AGGTCTGGGCTGAGGTCAGCTGG + Intronic
978372188 4:108040017-108040039 TAGTCTGTTCTCAGGCAAGCAGG + Intergenic
981143941 4:141303461-141303483 AAGTGTGTCCTGAGTGCAGCTGG + Intergenic
981343194 4:143646569-143646591 AAGTGAGTGCTGAGAGAAGGAGG - Intronic
981826256 4:148945091-148945113 AGGTCTGTGCTGAGTGAAAGAGG + Intergenic
982763586 4:159317471-159317493 GAGGCTGGGCTGATGGAAGCAGG + Intronic
983712879 4:170741410-170741432 AAGTCTGTGCAAAATGAAGCAGG - Intergenic
983996956 4:174193712-174193734 AGCTCTGAGCTGAGGGAAACAGG + Intergenic
984138308 4:175969805-175969827 AAGTGTGTGTGGAGGGATGCAGG + Intronic
984961039 4:185099246-185099268 CAGCCTCTGCTGTGGGAAGCAGG - Intergenic
985280312 4:188280014-188280036 AAGTCTGGGCAGGAGGAAGCGGG + Intergenic
987749139 5:22017250-22017272 AAGACTGTTCTGAGGGTTGCTGG + Intronic
989266714 5:39483241-39483263 AAGTCTGTGCAGACTGTAGCTGG + Intergenic
992974110 5:82095207-82095229 AAGTCTGAGTGGTGGGAAGCTGG + Intronic
994180263 5:96756391-96756413 AAGTCAGTCATGAGGGAAACAGG + Intronic
995587179 5:113660151-113660173 ATGTCTCTGCTGTGGGCAGCTGG + Intergenic
996769860 5:127074224-127074246 AGGTTTGTGCTAAGGGTAGCCGG + Intergenic
996803897 5:127433378-127433400 GCGTGTGTGCTGAGGGACGCTGG + Exonic
999770702 5:154773539-154773561 AGCACTGTGCTGGGGGAAGCAGG + Intronic
999937988 5:156508705-156508727 AAGTTTCTGCTGAGAGAAGGAGG + Intronic
1001815585 5:174666533-174666555 AGATCTGTGATGAGAGAAGCTGG - Intergenic
1002403353 5:179007347-179007369 AAGTGTGTGCTGAGGGCAACAGG - Intergenic
1003772118 6:9317007-9317029 AAGTCTTTCCTGAGCAAAGCTGG + Intergenic
1005514998 6:26545826-26545848 AAGTCTATGCTGATGGCATCGGG - Exonic
1005993890 6:30920366-30920388 ATGTCTGTGCTGAGTGAATGGGG + Exonic
1006716305 6:36122950-36122972 AAGCCTGTGGAGGGGGAAGCGGG + Intergenic
1007585640 6:42987466-42987488 AACACTGTGCTGAGGGAAGAGGG + Intronic
1008442084 6:51543382-51543404 AAAGCTGTGCTGAGAAAAGCGGG + Intergenic
1008652893 6:53581281-53581303 GAGTGAGTGCTCAGGGAAGCTGG + Intronic
1009435815 6:63617182-63617204 AAGTTTGTCCAGATGGAAGCAGG - Intergenic
1018092710 6:160358836-160358858 CAGTCTGAGCAGAGGGACGCTGG + Intronic
1018720011 6:166565362-166565384 CAGTCAGTCCCGAGGGAAGCTGG - Intronic
1018793167 6:167165531-167165553 CTGTCTTTGCTGATGGAAGCTGG - Intronic
1018908370 6:168088140-168088162 AAGCCGGGGCTGAGAGAAGCTGG + Intergenic
1019020547 6:168914164-168914186 AAGTCTGGGCAGATGGAAGCAGG + Intergenic
1021406305 7:20270927-20270949 GGGATTGTGCTGAGGGAAGCTGG + Intergenic
1021959276 7:25856574-25856596 AAGTGAGTGCTGAGAGGAGCTGG + Intergenic
1022459128 7:30587368-30587390 AAATCTTTGCTAAGGGAGGCTGG + Intergenic
1023074394 7:36468474-36468496 AATTCTGTGCTTAAGGAACCAGG - Intergenic
1023295244 7:38708130-38708152 AAATGAGTGCTGAGGGAACCTGG - Intergenic
1023766893 7:43520278-43520300 AGGTCTGTGCTGAGTAAAGGGGG - Intronic
1026396004 7:69955091-69955113 AAAGCTGTGCTGTAGGAAGCTGG + Intronic
1027365960 7:77458257-77458279 ATGGCTGTGCTGAGGGAGTCAGG + Intergenic
1027545364 7:79521204-79521226 AAGTTAGTGCTCAAGGAAGCTGG + Intergenic
1029503642 7:100949407-100949429 ACGTCAGCGCTGTGGGAAGCGGG - Intergenic
1031894942 7:127337858-127337880 AAGGCTGCGCTGGAGGAAGCGGG - Intergenic
1036777486 8:11623620-11623642 ATGTCTGTGATGATGGAGGCAGG - Intergenic
1039165170 8:34670933-34670955 ATGTGTGTGGTGGGGGAAGCAGG - Intergenic
1040060629 8:43100284-43100306 CAGTGTGTGCTTAGGGAAGTGGG + Intronic
1043475819 8:80605306-80605328 AACTATGTGCTGAGGTACGCTGG - Intergenic
1044274578 8:90285150-90285172 CATTCTGTGCTGAGAGCAGCAGG + Intergenic
1044528867 8:93285040-93285062 ACTTCTTTGCTGAAGGAAGCTGG - Intergenic
1044959886 8:97519933-97519955 AAATCTGTGCTGAGCCAATCTGG + Intergenic
1046635475 8:116670499-116670521 AAGTGCATGATGAGGGAAGCTGG + Intronic
1046966014 8:120166550-120166572 AAGATTGTGCTGAGTGATGCTGG - Intronic
1047202422 8:122778621-122778643 AAGTCTATTCTCTGGGAAGCAGG + Intergenic
1048332463 8:133480041-133480063 AAGTGTGCGGTGAGGGAGGCCGG + Intronic
1048391712 8:133973172-133973194 AAGTGTGTGCTGGGGGCAGGAGG + Intergenic
1048742802 8:137580671-137580693 AGGTGTGTACTGAGGGCAGCAGG - Intergenic
1049308077 8:141918051-141918073 AAGTCTGTGCACACGGAAGCAGG - Intergenic
1049365242 8:142233901-142233923 GATTCTGTGCAGGGGGAAGCTGG - Intronic
1049398949 8:142416287-142416309 GGGTCTGTCCTGGGGGAAGCCGG + Intergenic
1049429938 8:142556998-142557020 AAGCCTGTGCTCCGGGAAGAAGG - Intergenic
1049689141 8:143951144-143951166 AAGACTGTGCTGGGGCAAGTGGG + Intronic
1049791142 8:144473252-144473274 GTGTCGGTGCTGAGGGAAGAAGG - Exonic
1050206418 9:3201038-3201060 AACTATGTGCTGGGGGACGCTGG - Intergenic
1050420034 9:5453808-5453830 ATGTCTTTGCTGTGGGAGGCTGG + Intronic
1053406351 9:37879789-37879811 AAGGCAGTGCTGAGGGCAGAGGG + Intronic
1054998397 9:71420201-71420223 AAGTCTGTTATGAGGGAGACAGG + Intronic
1055730639 9:79276495-79276517 CAGACAGTGCTGAGGGAATCTGG + Intergenic
1056201388 9:84280250-84280272 AATTCTCTGCTGTGGGAAGAAGG + Intronic
1056643754 9:88392405-88392427 AATTCTGTGCTGAAGGTATCTGG + Intronic
1056885439 9:90438794-90438816 ATGTCTGTGCAGGGGAAAGCTGG - Intergenic
1058196587 9:101984381-101984403 AAGGCAGTGCTGAGAGAAGAAGG + Intergenic
1058460842 9:105181098-105181120 AAGTCTGTGCTGAAAGAATTGGG - Intergenic
1059516421 9:114900195-114900217 GAGGAAGTGCTGAGGGAAGCTGG + Intronic
1061097701 9:128469345-128469367 AAGTCTGAGGTGAGGGAGGTAGG + Exonic
1061112664 9:128585952-128585974 AAGACTCTGCTGAGGTAACCAGG + Exonic
1061374287 9:130214900-130214922 AGGTCTTTGCAGAGGGAAACTGG - Intronic
1061710413 9:132483543-132483565 AAGGCTGTGGTGGGGGAAGGAGG - Intronic
1189992642 X:46609269-46609291 CACTCTTTGCAGAGGGAAGCAGG + Intronic
1190681701 X:52831530-52831552 AAGGAGGTGCTGAGGGCAGCTGG + Intergenic
1190998796 X:55637550-55637572 AAGGGGGTGCTGAGGGCAGCTGG + Intergenic
1194134904 X:90129632-90129654 AAGTTGGTACTGAGGGAAGTGGG + Intergenic
1194302479 X:92204882-92204904 AAGTGAGTGCTGAGCGAAGGAGG + Intronic
1197723790 X:129762243-129762265 GGGTCTGGGCTGAGGGGAGCTGG - Intronic
1198186594 X:134259420-134259442 CAGCCTGTGCTGAGTGAAGTTGG - Intergenic
1199194804 X:145015903-145015925 AAGTCGGGGCGGAGGGGAGCGGG + Intergenic
1200480690 Y:3699723-3699745 AAGTTGGTACTGAGGGAAGTGGG + Intergenic
1200894995 Y:8366167-8366189 AAGTCAGTGATGAGGGGAGGAGG - Intergenic