ID: 1070152100

View in Genome Browser
Species Human (GRCh38)
Location 10:73811429-73811451
Sequence CTGAGCGCGACCGTGGGCGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 102}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070152084_1070152100 26 Left 1070152084 10:73811380-73811402 CCTGCGGGTGGTGATGGTGGCAA 0: 1
1: 0
2: 2
3: 8
4: 167
Right 1070152100 10:73811429-73811451 CTGAGCGCGACCGTGGGCGGGGG 0: 1
1: 0
2: 0
3: 2
4: 102
1070152083_1070152100 27 Left 1070152083 10:73811379-73811401 CCCTGCGGGTGGTGATGGTGGCA 0: 1
1: 0
2: 4
3: 15
4: 225
Right 1070152100 10:73811429-73811451 CTGAGCGCGACCGTGGGCGGGGG 0: 1
1: 0
2: 0
3: 2
4: 102
1070152093_1070152100 0 Left 1070152093 10:73811406-73811428 CCAAGGGAGTCTGTTGGGGGGGC 0: 1
1: 0
2: 3
3: 14
4: 153
Right 1070152100 10:73811429-73811451 CTGAGCGCGACCGTGGGCGGGGG 0: 1
1: 0
2: 0
3: 2
4: 102

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070152100 Original CRISPR CTGAGCGCGACCGTGGGCGG GGG Intronic
905859705 1:41342101-41342123 CTGTGTGTGCCCGTGGGCGGTGG + Intergenic
906614542 1:47225481-47225503 CAGCGCGCGGCCGGGGGCGGCGG + Exonic
913161858 1:116152303-116152325 CCGAGGGCCAGCGTGGGCGGAGG - Intergenic
1066406960 10:35127306-35127328 CCGAGCGGAGCCGTGGGCGGCGG + Intronic
1070152100 10:73811429-73811451 CTGAGCGCGACCGTGGGCGGGGG + Intronic
1070258005 10:74826932-74826954 CTGAGCGTGACGGTAGGGGGCGG + Intronic
1072654636 10:97321243-97321265 CGGAGCGCGGCCAGGGGCGGTGG - Exonic
1074143403 10:110696617-110696639 CCAAGCGCAACCGTGGGCTGGGG + Intronic
1076735424 10:132456908-132456930 CTGAGCGCGACCCTGCGTGAAGG + Intergenic
1076878674 10:133229840-133229862 CTGAGCCCGGGCGGGGGCGGCGG + Intergenic
1077459192 11:2700277-2700299 CTGAGCACCACCGGGGGCCGGGG + Intronic
1083879495 11:65540995-65541017 CTGAGCGCGCGCGTGGGCTTAGG + Intronic
1084858457 11:72003448-72003470 CTGAGAGGGACAGTAGGCGGAGG + Exonic
1092475841 12:8818466-8818488 CTGAGCTGGGCCGGGGGCGGTGG - Intergenic
1095261665 12:40105633-40105655 CAGAGCGCGGGCGCGGGCGGCGG - Exonic
1096282360 12:50267356-50267378 CTGGGCGTGACCGGGTGCGGTGG - Intronic
1096461136 12:51821851-51821873 AGGAGCGCGGCCGGGGGCGGCGG + Intergenic
1097021400 12:56023084-56023106 CTGAGGGCGGCCGGGCGCGGTGG - Intronic
1104708363 12:130966562-130966584 CTGAGAGCGGCTGTGGGCGCGGG + Intronic
1104708391 12:130966663-130966685 CTGAGAGTGACTGTGGGCCGGGG + Intronic
1105044052 12:132986817-132986839 CAGCGCGCGAACGTGGGCGTGGG + Exonic
1105937934 13:25119102-25119124 CTGAGCGAGCTCGTGGGCGTCGG - Intergenic
1107770990 13:43787249-43787271 GGCAGCGCGACCGTGGGCTGCGG - Intergenic
1108587419 13:51882873-51882895 CTGAGCAAGGCCCTGGGCGGAGG - Intergenic
1113751968 13:112782814-112782836 CTCAGCGCGACCTTGGGTCGTGG - Intronic
1113849859 13:113411946-113411968 GTGAGCGCAATAGTGGGCGGTGG - Intergenic
1119261059 14:73238108-73238130 CAGAGGGGGGCCGTGGGCGGGGG + Intronic
1120881455 14:89417501-89417523 GCGGCCGCGACCGTGGGCGGTGG + Intronic
1121144730 14:91574070-91574092 CTGCGGGCGACCGTGGGTGGTGG + Intergenic
1122880788 14:104689643-104689665 CGGAGCGCGGCAGTGGGCGCCGG + Exonic
1128256544 15:66201364-66201386 CTGAGAGCAACTGTGGGTGGGGG - Intronic
1129746363 15:78024211-78024233 CTGGGCGCCACGGTGGGAGGAGG + Exonic
1130132008 15:81151527-81151549 CTGAGTGCGAACTTGGTCGGTGG - Intergenic
1132556118 16:573385-573407 CCGGGTGCCACCGTGGGCGGGGG + Intronic
1132681846 16:1145694-1145716 CTGAGCCAGACCCGGGGCGGGGG - Intergenic
1136272018 16:29153948-29153970 ATGAGCGAGACGGTGGGGGGGGG - Intergenic
1139446314 16:67000813-67000835 CTGAGCGGGGCGGTGGGCGGCGG - Intronic
1141526960 16:84617951-84617973 CCGAGCGCGCCCCTGGCCGGCGG + Exonic
1141989649 16:87602684-87602706 CTGCGGGCGCCCGAGGGCGGCGG - Intronic
1142209892 16:88803992-88804014 CTGGTCGCGTCCGGGGGCGGCGG - Exonic
1143515435 17:7417317-7417339 CTGAGCGTCACCGTGGCCGTGGG + Exonic
1154300425 18:13186637-13186659 CTGAGCCCGACCGTGGCCCTGGG - Intergenic
1157849866 18:51038238-51038260 CAGAGCGAGACTGTGGGGGGGGG + Intronic
1160577382 18:79864292-79864314 GTGAGCGCGGCCGGGGGTGGCGG + Intronic
1160873225 19:1286309-1286331 GTGAGCGCGGCCGCGCGCGGGGG + Intronic
1160991920 19:1863620-1863642 CCGAGCGCGGGCGTCGGCGGCGG - Intergenic
1162079259 19:8209050-8209072 CGGAGCGGGAACGGGGGCGGGGG + Intronic
1162742688 19:12782649-12782671 GTGCGCGCGTGCGTGGGCGGTGG + Intronic
1163815746 19:19463498-19463520 CTGAGCAGGAGCGGGGGCGGGGG + Intronic
1165080011 19:33301714-33301736 CTGGGCACGGGCGTGGGCGGCGG + Exonic
1165333575 19:35154606-35154628 CTGAGGGCGACGGGGGGCAGGGG - Intergenic
1166835430 19:45664725-45664747 CTGTGCGTGACTGTGGGAGGTGG + Intergenic
1168072950 19:53962953-53962975 CAGAGCGCGGCCATGGTCGGCGG - Intergenic
924987713 2:287550-287572 CCGAGCGCGCCCGAGGGCCGGGG - Intronic
925027505 2:621281-621303 CTGCGCGCGCCCCAGGGCGGAGG - Intergenic
925176607 2:1788855-1788877 CTGAGAGCGAGCCTGGACGGAGG - Intergenic
930358228 2:50346894-50346916 CTGGGCTCGCCCGGGGGCGGCGG - Intronic
935112451 2:100105227-100105249 CTGGGCGCTCCCGCGGGCGGCGG + Intronic
938126158 2:128672639-128672661 CTGAGAGCGAGCGAGGGCTGTGG + Intergenic
938451528 2:131425265-131425287 CTGAGCGAGGCCGGGCGCGGCGG - Intergenic
939433038 2:142135206-142135228 CTGAGAGAGACAGGGGGCGGAGG + Intergenic
948645269 2:239400552-239400574 CCGCGCGCGGCCGTGGGAGGCGG - Exonic
1173470823 20:43322026-43322048 CTGAGAGGGAGGGTGGGCGGAGG + Intergenic
1174072470 20:47908775-47908797 CAGAGCCAGACCGGGGGCGGGGG - Intergenic
1175864412 20:62167328-62167350 CTGAGCTCGGCCGGGCGCGGTGG - Intronic
1176306930 21:5128498-5128520 GTGAGTGCGCCGGTGGGCGGGGG + Intergenic
1178083296 21:29087878-29087900 ATGAGCACGACCGGGCGCGGTGG - Intronic
1183666404 22:39248829-39248851 CTGAACGCGAAGATGGGCGGGGG - Intergenic
953596385 3:44318474-44318496 CTGAGGGCCACGGTGGGGGGTGG + Intronic
954628541 3:52035956-52035978 CTGAGCCTGACCCTGGGCTGGGG - Intergenic
959683103 3:109118138-109118160 CTGCGCGTGAGCGTGGGCGTGGG - Exonic
961446326 3:126983313-126983335 CGGCGCGGGACGGTGGGCGGGGG + Intergenic
965928134 3:174008359-174008381 CAGAGCTCCTCCGTGGGCGGGGG - Intronic
966860874 3:184230357-184230379 CTGAGGGCGACAGGTGGCGGGGG - Intronic
968084890 3:195869846-195869868 CTGAGCTCGGCCGTGGAAGGAGG + Intronic
968232510 3:197012068-197012090 CTGAGCGCGACTGTGTGTGACGG - Intronic
968914097 4:3489617-3489639 CTGCGGGCGAGGGTGGGCGGTGG + Intronic
973183323 4:47294478-47294500 ATGAGCGAGACTGTGGGCGTAGG - Intronic
977908369 4:102501906-102501928 CTGGGCTAGACCGTGGGAGGAGG + Intronic
979189247 4:117835728-117835750 CTGAGTTCGCCCGAGGGCGGTGG - Intergenic
985492842 5:189308-189330 GTGAGCCCGGCCATGGGCGGTGG - Exonic
985737900 5:1595057-1595079 CTGACCACGGCCGTGCGCGGTGG - Intergenic
993457468 5:88142526-88142548 CTGCCCGTGCCCGTGGGCGGAGG - Intergenic
993503087 5:88683753-88683775 CTGAGCGCTGCCAGGGGCGGGGG - Intergenic
995527210 5:113059593-113059615 CTGAGAGCGACTGTGGGGGAAGG + Intronic
999232616 5:150070420-150070442 CCGAGCGCCACCTGGGGCGGAGG - Intronic
1001462134 5:171925084-171925106 CGGAGCGCGGCCCTGGGCAGGGG + Intronic
1005118431 6:22364118-22364140 CCGAGCTCCACGGTGGGCGGAGG + Intergenic
1018969732 6:168517920-168517942 CGGAGCGCGAGCCTGGGCCGGGG + Intronic
1020132743 7:5568753-5568775 CTGAGAGCGGCCGGGCGCGGTGG + Intergenic
1025800664 7:64784131-64784153 CTGAGGGAGACCGTGGGGAGAGG - Intergenic
1038008839 8:23457699-23457721 CGGAGCGCGCCCGCTGGCGGCGG + Intergenic
1039781761 8:40793077-40793099 CTGAGCGCAACAGTGGGCTTTGG + Intronic
1041072177 8:54135808-54135830 CTGGGTGCGGCCGGGGGCGGTGG - Intronic
1041642844 8:60220900-60220922 CTGAGGGCAACTGTGGGAGGAGG + Intronic
1041661447 8:60405368-60405390 CAGAGAGCCTCCGTGGGCGGTGG - Intergenic
1042325443 8:67522900-67522922 CTGAGTGAGACCTTGGGCAGAGG + Intronic
1049676086 8:143889886-143889908 CTGAGCGCGACTCTGCGGGGTGG - Intergenic
1055611756 9:78031517-78031539 CTGAGCGAGGCCGGGCGCGGCGG - Intergenic
1058991281 9:110256746-110256768 CTGCGCGTGACGGTGGGAGGCGG + Intergenic
1060114346 9:120928803-120928825 GTGAGCCCGCCCGAGGGCGGGGG + Intronic
1060175230 9:121492759-121492781 CTGAACTCGACCGGGCGCGGTGG - Intergenic
1060977157 9:127771448-127771470 CGGAGCGAGACCGCAGGCGGAGG - Intronic
1062367309 9:136216985-136217007 CGGAGCGAGGCCGTGGGCGCAGG - Intronic
1194714844 X:97276252-97276274 CTGAGGGAGACCGTGGGGAGAGG + Intronic