ID: 1070154680

View in Genome Browser
Species Human (GRCh38)
Location 10:73826062-73826084
Sequence GGACAGAGTAGGCCACACAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070154672_1070154680 -5 Left 1070154672 10:73826044-73826066 CCCAGAATCCAGCCCCCAGGACA 0: 1
1: 1
2: 0
3: 30
4: 293
Right 1070154680 10:73826062-73826084 GGACAGAGTAGGCCACACACAGG No data
1070154670_1070154680 17 Left 1070154670 10:73826022-73826044 CCAGCGGGGCTGTAGCTGTAGTC 0: 1
1: 0
2: 0
3: 11
4: 79
Right 1070154680 10:73826062-73826084 GGACAGAGTAGGCCACACACAGG No data
1070154669_1070154680 18 Left 1070154669 10:73826021-73826043 CCCAGCGGGGCTGTAGCTGTAGT 0: 1
1: 0
2: 1
3: 4
4: 63
Right 1070154680 10:73826062-73826084 GGACAGAGTAGGCCACACACAGG No data
1070154673_1070154680 -6 Left 1070154673 10:73826045-73826067 CCAGAATCCAGCCCCCAGGACAG 0: 1
1: 0
2: 3
3: 27
4: 353
Right 1070154680 10:73826062-73826084 GGACAGAGTAGGCCACACACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070154680 Original CRISPR GGACAGAGTAGGCCACACAC AGG Intronic
No off target data available for this crispr