ID: 1070159121

View in Genome Browser
Species Human (GRCh38)
Location 10:73854980-73855002
Sequence CATTATATCCAATAATGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 728
Summary {0: 1, 1: 0, 2: 0, 3: 27, 4: 700}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070159121_1070159125 5 Left 1070159121 10:73854980-73855002 CCCTCCCATTATTGGATATAATG 0: 1
1: 0
2: 0
3: 27
4: 700
Right 1070159125 10:73855008-73855030 ATCCAATATACATTCTCTCCTGG No data
1070159121_1070159129 27 Left 1070159121 10:73854980-73855002 CCCTCCCATTATTGGATATAATG 0: 1
1: 0
2: 0
3: 27
4: 700
Right 1070159129 10:73855030-73855052 GGCAAAGAAGATGCTTCCCTAGG No data
1070159121_1070159126 6 Left 1070159121 10:73854980-73855002 CCCTCCCATTATTGGATATAATG 0: 1
1: 0
2: 0
3: 27
4: 700
Right 1070159126 10:73855009-73855031 TCCAATATACATTCTCTCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070159121 Original CRISPR CATTATATCCAATAATGGGA GGG (reversed) Intronic
901290872 1:8123361-8123383 TATTATCTCCAAAAATGGCAAGG - Intergenic
903904678 1:26676200-26676222 CATGAAATCCATTAATGGTATGG + Intergenic
905138696 1:35822840-35822862 CATTATCTCCATTACTGTGAAGG + Exonic
907005131 1:50905390-50905412 ATATATACCCAATAATGGGATGG + Intronic
907282532 1:53360499-53360521 CTTTTTTTCCAATAAAGGGAGGG + Intergenic
907393518 1:54174243-54174265 CATTAGATCCTCTAATCGGAGGG + Intronic
907692253 1:56680864-56680886 CTATATACCCAGTAATGGGATGG + Intronic
907815447 1:57914080-57914102 GAATATACCCAGTAATGGGATGG - Intronic
909239332 1:73192174-73192196 CATTGCATCCCATAGTGGGAGGG - Intergenic
909308212 1:74109813-74109835 CATTTTAATAAATAATGGGAAGG + Intronic
909807411 1:79889064-79889086 GTATATATCCAGTAATGGGATGG + Intergenic
909853728 1:80502300-80502322 GTATATACCCAATAATGGGATGG - Intergenic
909854751 1:80514412-80514434 GTATATACCCAATAATGGGATGG + Intergenic
909870781 1:80735713-80735735 GTATATATCCAGTAATGGGATGG - Intergenic
910481956 1:87668651-87668673 CTATATACCCAGTAATGGGATGG - Intergenic
910644292 1:89496608-89496630 TATTATACCCAGTAATGGGATGG - Intergenic
910701527 1:90080265-90080287 GTTTATACCCAGTAATGGGATGG - Intergenic
911034382 1:93524862-93524884 CTTTATTTCCTACAATGGGAAGG - Intronic
911318352 1:96381736-96381758 CTATATACCCAGTAATGGGATGG - Intergenic
911677634 1:100677430-100677452 GTATATATCCAGTAATGGGATGG + Intergenic
911810045 1:102264701-102264723 GTATATATCCAGTAATGGGATGG - Intergenic
912071502 1:105816181-105816203 GTATATATCCAGTAATGGGATGG + Intergenic
913408255 1:118520085-118520107 GTATATACCCAATAATGGGATGG + Intergenic
913419836 1:118653654-118653676 GTATATATCCAGTAATGGGATGG + Intergenic
913527361 1:119706628-119706650 GGGTATATCCAGTAATGGGATGG - Intronic
913638849 1:120791282-120791304 GTATATATCCAGTAATGGGATGG - Intergenic
914208205 1:145553822-145553844 GTATATACCCAATAATGGGATGG + Intergenic
914783349 1:150805922-150805944 CTTTATATCCCAGAATGGGAAGG - Exonic
915521799 1:156449728-156449750 GATAATATCCAATATTGGCAAGG + Intergenic
915990348 1:160509139-160509161 GTTTATACCCAGTAATGGGATGG - Intronic
917484148 1:175440010-175440032 GTATATACCCAATAATGGGATGG - Intronic
917610917 1:176688288-176688310 AATTATATCCACTGATGTGAAGG + Intronic
918548559 1:185713052-185713074 GTTTATACCCAGTAATGGGATGG - Intergenic
918679311 1:187332201-187332223 GTATATATCCAGTAATGGGATGG + Intergenic
918713180 1:187757038-187757060 GAATATACCCAGTAATGGGATGG + Intergenic
919001160 1:191833015-191833037 GTATATACCCAATAATGGGATGG - Intergenic
919161535 1:193836804-193836826 GTATATACCCAATAATGGGATGG - Intergenic
919183607 1:194117076-194117098 GTATATACCCAATAATGGGATGG + Intergenic
919383103 1:196882742-196882764 GTATATACCCAATAATGGGATGG - Intronic
919479826 1:198074604-198074626 AATTCTATCTAATCATGGGAGGG - Intergenic
921287950 1:213625935-213625957 GTATATATCCAGTAATGGGATGG + Intergenic
921793931 1:219320946-219320968 GTATATATCCAGTAATGGGATGG + Intergenic
923320187 1:232824387-232824409 GTATATATCCAGTAATGGGATGG - Intergenic
1063071274 10:2668594-2668616 CATTATATCCCTTACTGGAAAGG - Intergenic
1063263198 10:4413896-4413918 GTATATATCCAGTAATGGGATGG + Intergenic
1063553798 10:7058535-7058557 GTATATACCCAATAATGGGATGG + Intergenic
1063577349 10:7273914-7273936 GTATATATCCAGTAATGGGATGG - Intronic
1063752227 10:8963251-8963273 TATTATACCCAGTAATGGGATGG - Intergenic
1063983052 10:11471461-11471483 GTATATATCCAGTAATGGGATGG - Intronic
1064041825 10:11972889-11972911 GTATATATCCAGTAATGGGATGG + Intronic
1065155044 10:22860904-22860926 GTATATATCCAGTAATGGGATGG - Intergenic
1065158002 10:22890579-22890601 GTATATATCCAGTAATGGGATGG - Intergenic
1065276245 10:24088800-24088822 GTATATATCCAGTAATGGGATGG + Intronic
1066121415 10:32291120-32291142 AATAGTATCTAATAATGGGATGG - Intronic
1066150846 10:32615184-32615206 GTATATATCCAATAGTGGGATGG + Intronic
1066719406 10:38321644-38321666 CATTAAATCCTCTAATGAGATGG + Intergenic
1066724203 10:38373159-38373181 GTATATATCCAATAATGGGATGG + Intergenic
1068105244 10:52606747-52606769 CTATATACCCAGTAATGGGACGG - Intergenic
1068231944 10:54179053-54179075 GTATATATCCAGTAATGGGATGG - Intronic
1068254617 10:54493722-54493744 CTATATACCCAGTAATGGGATGG - Intronic
1068256738 10:54520699-54520721 GTATATATCCAGTAATGGGATGG - Intronic
1068346418 10:55785100-55785122 CAATATATCCAATTACTGGATGG + Intergenic
1068793827 10:61055704-61055726 GTATATATCCAGTAATGGGATGG + Intergenic
1069009501 10:63355786-63355808 GATCATATACAATAATGAGATGG + Intronic
1070159121 10:73854980-73855002 CATTATATCCAATAATGGGAGGG - Intronic
1070701686 10:78606681-78606703 GAATATACCCAGTAATGGGATGG + Intergenic
1071152066 10:82647510-82647532 GTATATATCCAGTAATGGGATGG + Intronic
1071323250 10:84486249-84486271 GTATATATCCAGTAATGGGATGG + Intronic
1071413241 10:85417478-85417500 GTATATATCCAGTAATGGGATGG - Intergenic
1071459846 10:85882258-85882280 GTATATATCCAGTAATGGGATGG - Intronic
1071983662 10:91029409-91029431 GTATATATCCAGTAATGGGATGG - Intergenic
1072752955 10:97996719-97996741 GTATATACCCAATAATGGGATGG - Intronic
1072869731 10:99104547-99104569 GTATATACCCAATAATGGGATGG - Intronic
1074023806 10:109612929-109612951 GTATATACCCAATAATGGGATGG + Intergenic
1074045157 10:109831328-109831350 GTATATATCCAGTAATGGGATGG - Intergenic
1074255348 10:111796914-111796936 GTATATATCCAGTAATGGGATGG + Intergenic
1075510792 10:123071285-123071307 ATGTCTATCCAATAATGGGAAGG + Intergenic
1075974272 10:126681943-126681965 GTATATATCCAGTAATGGGATGG - Intergenic
1076254449 10:129010731-129010753 GAATATACCCAGTAATGGGATGG + Intergenic
1077642919 11:3898019-3898041 GGTTATACCCAGTAATGGGATGG + Intronic
1077672726 11:4170748-4170770 GGTTATACCCAGTAATGGGATGG + Intergenic
1077748293 11:4934079-4934101 CTATATACCCAGTAATGGGATGG + Intronic
1077767505 11:5176454-5176476 CAGTATTTCCATTATTGGGAAGG - Intronic
1078353511 11:10615417-10615439 GTATATATCCAGTAATGGGATGG - Intronic
1078647799 11:13158217-13158239 GTATATATCCAGTAATGGGATGG + Intergenic
1078990200 11:16638424-16638446 GATTATACCCAGTAATGGGATGG + Intronic
1079258175 11:18851328-18851350 CATTCTATTCAATAATAGAAAGG + Intergenic
1079819690 11:25109795-25109817 GTATATATCCAGTAATGGGATGG + Intergenic
1079901006 11:26184749-26184771 GTATATACCCAATAATGGGATGG - Intergenic
1080094448 11:28389187-28389209 GTATATACCCAATAATGGGATGG + Intergenic
1080177644 11:29385337-29385359 GTATATATCCAGTAATGGGATGG + Intergenic
1080917976 11:36679553-36679575 GTATATACCCAATAATGGGACGG - Intergenic
1081459213 11:43255873-43255895 GTATATATCCAGTAATGGGATGG - Intergenic
1082143953 11:48644717-48644739 GTATATACCCAATAATGGGATGG + Intergenic
1082246341 11:49927549-49927571 GAATATACCCAGTAATGGGATGG + Intergenic
1082292198 11:50389501-50389523 GTATATATCCAGTAATGGGATGG - Intergenic
1082311431 11:50654086-50654108 GTATATACCCAATAATGGGATGG - Intergenic
1082571146 11:54742025-54742047 GTATATACCCAATAATGGGATGG + Intergenic
1082571231 11:54742895-54742917 ATGTATACCCAATAATGGGATGG + Intergenic
1082622305 11:55438670-55438692 GTATATATCCAGTAATGGGATGG - Intergenic
1082636083 11:55596064-55596086 ATATATATCCAGTAATGGGATGG + Intergenic
1082719419 11:56655528-56655550 GTATATATCCAGTAATGGGATGG + Intergenic
1083021027 11:59507529-59507551 GTTTATACCCAGTAATGGGATGG + Intergenic
1083068507 11:59950645-59950667 CATTAGATCCAGCAATGTGAGGG + Intergenic
1083073544 11:60013095-60013117 GTATATATCCAGTAATGGGATGG - Intergenic
1083511393 11:63212302-63212324 GTATATATCCAGTAATGGGATGG - Intronic
1083523727 11:63341204-63341226 CTATATACCCAGTAATGGGATGG - Intronic
1084005453 11:66320806-66320828 GTATATATCCAGTAATGGGATGG - Intergenic
1084250609 11:67895792-67895814 GTATATATCCAGTAATGGGATGG - Intergenic
1085491916 11:76927966-76927988 GTATATACCCAATAATGGGATGG + Intronic
1085495923 11:76969430-76969452 GTATATACCCAATAATGGGATGG - Intronic
1085848455 11:80093540-80093562 GTATATACCCAATAATGGGATGG - Intergenic
1086267591 11:85019973-85019995 CTATATACCCAGTAATGGGATGG + Intronic
1086423000 11:86656234-86656256 GTATATATCCAGTAATGGGATGG - Intronic
1086586462 11:88458358-88458380 CTATATACCCAGTAATGGGATGG + Intergenic
1086777694 11:90859993-90860015 TTATATACCCAATAATGGGATGG - Intergenic
1086811559 11:91316805-91316827 GTGTATATCCAGTAATGGGATGG + Intergenic
1087120777 11:94571791-94571813 GTATATATCCAGTAATGGGATGG + Intronic
1087352847 11:97055266-97055288 GTATATATCCAGTAATGGGATGG - Intergenic
1087406908 11:97742063-97742085 GTATATATCCAGTAATGGGATGG + Intergenic
1087736778 11:101842936-101842958 GTATATATCCAGTAATGGGATGG - Intronic
1087753625 11:102031924-102031946 GTATATATCCAGTAATGGGATGG + Intergenic
1087929175 11:103956567-103956589 GTATATATCCAGTAATGGGATGG + Intronic
1088453214 11:110004518-110004540 GTATATACCCAATAATGGGATGG + Intergenic
1088508501 11:110550345-110550367 GTATATATCCAGTAATGGGATGG + Intergenic
1088846438 11:113672276-113672298 GTATATATCCAGTAATGGGATGG - Intergenic
1091636962 12:2204428-2204450 GTATATATCCAGTAATGGGATGG - Intronic
1091900264 12:4138894-4138916 GTATATATCCAGTAATGGGATGG + Intergenic
1092297722 12:7214208-7214230 GAATATACCCAGTAATGGGATGG - Intronic
1092301690 12:7256735-7256757 GAATATACCCAGTAATGGGATGG - Intergenic
1092496780 12:9004209-9004231 GAATATACCCAGTAATGGGATGG + Intronic
1092690416 12:11103176-11103198 TTATATATCCAGTAATGGGATGG - Intronic
1092694156 12:11150305-11150327 GTTTATACCCAGTAATGGGATGG - Intronic
1092706409 12:11290075-11290097 GTATATATCCAGTAATGGGATGG - Intergenic
1093105080 12:15076568-15076590 GTATATATCCAGTAATGGGATGG - Intergenic
1093178768 12:15944234-15944256 GTATATATCCAGTAATGGGATGG + Intronic
1093313720 12:17623068-17623090 CTATATACCCAGTAATGGGATGG + Intergenic
1093394481 12:18664642-18664664 GTATATACCCAATAATGGGATGG - Intergenic
1093782361 12:23151473-23151495 GTATATATCCAGTAATGGGATGG - Intergenic
1094300740 12:28962379-28962401 CAAAATAACCAATATTGGGAGGG + Intergenic
1094405815 12:30115193-30115215 GTATATATCCAGTAATGGGATGG + Intergenic
1094478064 12:30857246-30857268 GTATATATCCAGTAATGGGATGG - Intergenic
1094632448 12:32189417-32189439 CATTATATCCAATATTGACAGGG - Intronic
1094858014 12:34425986-34426008 GTATATATCCAGTAATGGGATGG + Intergenic
1095032934 12:37318381-37318403 GTATATATCCAGTAATGGGATGG + Intergenic
1095083782 12:38037050-38037072 GTATATATCCAGTAATGGGATGG - Intergenic
1095425298 12:42068595-42068617 GTATATATCCAGTAATGGGATGG - Intergenic
1095765715 12:45893076-45893098 CATTATATTCAAAGATGAGAAGG + Intronic
1096730436 12:53607068-53607090 GTATATATCCAGTAATGGGATGG + Intronic
1096963737 12:55607319-55607341 CCTTATAGCTAATAATGGCATGG - Intergenic
1097142390 12:56913080-56913102 GTATATACCCAATAATGGGATGG + Intergenic
1097418170 12:59339822-59339844 GTATATATCCAGTAATGGGATGG + Intergenic
1097508438 12:60505868-60505890 CCTTATACCCAGTAATGGGATGG - Intergenic
1098053470 12:66478513-66478535 GTATATATCCAGTAATGGGATGG - Intronic
1098200167 12:68045840-68045862 GTATATACCCAATAATGGGATGG + Intergenic
1098699949 12:73611320-73611342 GTATATATCCAGTAATGGGATGG - Intergenic
1098735155 12:74092162-74092184 GTATATATCCAGTAATGGGATGG - Intergenic
1099241513 12:80144561-80144583 GTATATATCCAGTAATGGGATGG + Intergenic
1099271882 12:80520866-80520888 GTATATATCCAGTAATGGGATGG + Intronic
1099358356 12:81666246-81666268 GTATATACCCAATAATGGGATGG - Intronic
1099420166 12:82448012-82448034 CATTAAAAACAAGAATGGGATGG - Intronic
1099737292 12:86586456-86586478 GTATATATCCAGTAATGGGATGG + Intronic
1099756565 12:86858285-86858307 GCATATACCCAATAATGGGATGG + Intergenic
1099765392 12:86975993-86976015 CTATATACCCAGTAATGGGATGG - Intergenic
1099834377 12:87888853-87888875 CTATATACCCAGTAATGGGATGG + Intergenic
1100127895 12:91452723-91452745 GTATATACCCAATAATGGGATGG + Intergenic
1101600256 12:106203492-106203514 GTATATACCCAATAATGGGATGG - Intergenic
1101850428 12:108397565-108397587 GTATATACCCAATAATGGGATGG - Intergenic
1105201878 13:18187807-18187829 GTATATATCCAGTAATGGGATGG - Intergenic
1105445392 13:20450696-20450718 GTATATATCCAGTAATGGGATGG - Intronic
1105905627 13:24807154-24807176 GTATATATCCAGTAATGGGATGG + Intronic
1106317245 13:28605516-28605538 GTATATATCCAGTAATGGGATGG + Intergenic
1107153598 13:37140826-37140848 TTTTATACCCAGTAATGGGATGG + Intergenic
1107154471 13:37150460-37150482 GTATATATCCAGTAATGGGATGG + Intergenic
1107646703 13:42501593-42501615 CTATATACCCAGTAATGGGATGG - Intergenic
1107681728 13:42858763-42858785 GAATATACCCAGTAATGGGATGG - Intergenic
1108175405 13:47787389-47787411 GTATATATCCAGTAATGGGATGG - Intergenic
1108457256 13:50628884-50628906 GTATATACCCAATAATGGGATGG + Intronic
1109216554 13:59596256-59596278 GTATATATCCAGTAATGGGATGG - Intergenic
1109322439 13:60827702-60827724 GTTTATACCCAGTAATGGGATGG + Intergenic
1109365850 13:61355356-61355378 GTATATATCCAGTAATGGGATGG + Intergenic
1109719071 13:66254268-66254290 GTATATATCCAGTAATGGGATGG + Intergenic
1109904647 13:68823596-68823618 CATTATTTGCAATCATGGAAAGG - Intergenic
1109946262 13:69436181-69436203 GTATATATCCAGTAATGGGATGG - Intergenic
1110506996 13:76298670-76298692 GTATATATCCAGTAATGGGATGG - Intergenic
1110891104 13:80699724-80699746 CTATATACCCAGTAATGGGATGG + Intergenic
1111499884 13:89104656-89104678 GTATATACCCAATAATGGGATGG - Intergenic
1111617251 13:90675717-90675739 CGTTAAAGCCAATCATGGGATGG - Intergenic
1111844175 13:93488475-93488497 CTATATACCCAGTAATGGGATGG + Intronic
1112937532 13:104820029-104820051 CTATATACCCAGTAATGGGATGG - Intergenic
1113032966 13:106014823-106014845 ATTTATACCCAGTAATGGGATGG + Intergenic
1113121628 13:106929838-106929860 GTATATACCCAATAATGGGATGG + Intergenic
1113155552 13:107316403-107316425 ATTTATACCCAGTAATGGGATGG + Intronic
1113488623 13:110675193-110675215 GTATATATCCAGTAATGGGATGG - Intronic
1114798634 14:25745032-25745054 GTATATACCCAATAATGGGATGG + Intergenic
1114848016 14:26347545-26347567 CAGTGTAACCAATAATGGGAGGG - Intergenic
1114974228 14:28074117-28074139 GTATATATCCAGTAATGGGATGG + Intergenic
1115698110 14:35922578-35922600 GTATATATCCAGTAATGGGATGG - Intronic
1115844165 14:37507240-37507262 GTATATATCCAGTAATGGGATGG - Intronic
1116202308 14:41813698-41813720 CTATATACCCAGTAATGGGATGG + Intronic
1116438300 14:44920215-44920237 CATTATATACAAGAATGGCAGGG - Intergenic
1116545555 14:46161642-46161664 CTATATACCCAGTAATGGGATGG + Intergenic
1116604258 14:46969255-46969277 CTATATACCCAGTAATGGGATGG + Intronic
1117350405 14:54875982-54876004 GTATATACCCAATAATGGGATGG - Intronic
1117848928 14:59947012-59947034 GTATATATCCAGTAATGGGATGG + Intronic
1119100293 14:71873147-71873169 GTATATATCCAGTAATGGGATGG + Intergenic
1119146869 14:72324861-72324883 GTATATATCCAGTAATGGGATGG + Intronic
1119255506 14:73192569-73192591 CATTATTTAGAATAATGTGATGG - Intronic
1119452881 14:74727112-74727134 GTATATATCCAGTAATGGGATGG + Intronic
1120804455 14:88731574-88731596 GTATATATCCAGTAATGGGATGG + Intronic
1120936789 14:89904481-89904503 GTATATATCCAGTAATGGGATGG + Intronic
1121910556 14:97787584-97787606 GTATATACCCAATAATGGGATGG + Intergenic
1202830010 14_GL000009v2_random:17827-17849 ATATATATCCAGTAATGGGATGG + Intergenic
1123822891 15:24048820-24048842 GTATATATCCAGTAATGGGATGG - Intergenic
1124092473 15:26619153-26619175 GTATATATCCAGTAATGGGATGG - Intronic
1125784703 15:42305581-42305603 AAATATACCCAGTAATGGGATGG - Intronic
1125977058 15:43963542-43963564 GAATATACCCAGTAATGGGATGG - Intronic
1126234077 15:46362232-46362254 GTATATATCCAGTAATGGGATGG + Intergenic
1126897944 15:53280012-53280034 GTATATATCCAGTAATGGGATGG + Intergenic
1128416247 15:67448733-67448755 TGATATACCCAATAATGGGATGG + Intronic
1130701307 15:86185391-86185413 GTATATATCCAGTAATGGGATGG - Intronic
1131345368 15:91642717-91642739 GTATATACCCAATAATGGGATGG + Intergenic
1133082265 16:3331711-3331733 GAATATACCCAGTAATGGGATGG - Intergenic
1134254062 16:12597259-12597281 CTATATACCCAGTAATGGGATGG - Intergenic
1135149868 16:19996033-19996055 GTATATATCCAGTAATGGGATGG + Intergenic
1135895949 16:26402640-26402662 GTATATATCCAGTAATGGGATGG + Intergenic
1136907298 16:34109441-34109463 CTATATACCCAGTAATGGGATGG - Intergenic
1137064481 16:35825769-35825791 GTATATACCCAATAATGGGATGG + Intergenic
1137335203 16:47541502-47541524 GAATATACCCAGTAATGGGATGG + Intronic
1137336830 16:47557869-47557891 GAATATACCCAGTAATGGGATGG - Intronic
1138100464 16:54248075-54248097 GTTTATACCCAGTAATGGGATGG + Intronic
1138325242 16:56160127-56160149 GTATATACCCAATAATGGGATGG - Intergenic
1138722848 16:59102016-59102038 GTATATATCCAGTAATGGGATGG - Intergenic
1138870647 16:60879480-60879502 GTATATATCCAGTAATGGGATGG - Intergenic
1139152122 16:64395321-64395343 GTATATATCCAGTAATGGGATGG + Intergenic
1139886423 16:70211204-70211226 GTATATATCCAGTAATGGGATGG - Intergenic
1140378894 16:74468840-74468862 CATTTTATCCACTACTGTGATGG - Intronic
1140582650 16:76249794-76249816 GTATATATCCAGTAATGGGATGG + Intergenic
1140586541 16:76299630-76299652 GTATATATCCAGTAATGGGATGG - Intronic
1142797805 17:2322442-2322464 CATTACATCCACAAAAGGGAAGG + Intronic
1144089793 17:11845511-11845533 CTATATACCCAGTAATGGGATGG + Intronic
1145396263 17:22497458-22497480 GTATATATCCAGTAATGGGATGG + Intergenic
1149070253 17:52533023-52533045 CATTATTTCCACTTCTGGGAAGG + Intergenic
1149936728 17:60814935-60814957 GTATATATCCAGTAATGGGATGG - Intronic
1153790412 18:8573720-8573742 GTATATACCCAATAATGGGATGG + Intergenic
1153827051 18:8884547-8884569 GTATATATCCAGTAATGGGATGG + Intergenic
1154517707 18:15191139-15191161 GTATATATCCAGTAATGGGATGG - Intergenic
1155598481 18:27515514-27515536 GTATATATCCAGTAATGGGATGG - Intergenic
1155985728 18:32228582-32228604 GTATATATCCAGTAATGGGATGG + Intronic
1157115469 18:44858937-44858959 GATGGTAACCAATAATGGGAAGG - Intronic
1157650831 18:49328918-49328940 GTATATATCCAGTAATGGGATGG - Intronic
1158000599 18:52613851-52613873 TGTTATATCCAACACTGGGAAGG + Intronic
1158100503 18:53824524-53824546 GTATATACCCAATAATGGGATGG - Intergenic
1158100908 18:53828889-53828911 GTATATACCCAATAATGGGATGG + Intergenic
1158281624 18:55834408-55834430 GTATATACCCAATAATGGGATGG - Intergenic
1158740253 18:60133944-60133966 ATATATACCCAATAATGGGATGG - Intergenic
1158792395 18:60797672-60797694 GTATATATCCAGTAATGGGATGG + Intergenic
1159085830 18:63790774-63790796 GTATATATCCAGTAATGGGATGG - Intronic
1159087853 18:63814255-63814277 GTATATATCCAATAATGGGATGG + Intergenic
1159516526 18:69465812-69465834 GTATATATCCAGTAATGGGATGG + Intronic
1159628305 18:70719922-70719944 GTATATACCCAATAATGGGATGG - Intergenic
1162836310 19:13320468-13320490 ATTTATATCCAATAATCGTAAGG - Intronic
1164326592 19:24198284-24198306 GTTTATATCTAGTAATGGGATGG + Intergenic
1164360209 19:27499058-27499080 GTTTATACCCAGTAATGGGATGG - Intergenic
1165288669 19:34865689-34865711 GTATATATCCAGTAATGGGATGG - Intergenic
1166467509 19:43045455-43045477 CTATATACCCAGTAATGGGATGG - Intronic
1168207636 19:54863361-54863383 GTTTATACCCAGTAATGGGATGG + Intronic
1202642679 1_KI270706v1_random:109958-109980 ATATATATCCAGTAATGGGATGG - Intergenic
924996986 2:370575-370597 GCATATACCCAATAATGGGATGG + Intergenic
925173258 2:1765548-1765570 ATATATACCCAATAATGGGATGG - Intergenic
925182369 2:1825632-1825654 TCTTATATCCAATAAAGAGATGG - Intronic
926303419 2:11619575-11619597 GATAATATCCAATAGTGTGAGGG - Intronic
926495426 2:13580988-13581010 GTATATACCCAATAATGGGATGG + Intergenic
927106599 2:19833000-19833022 GTATATACCCAATAATGGGATGG - Intergenic
927127564 2:20026577-20026599 GTATATATCCAGTAATGGGATGG - Intergenic
928046306 2:27936433-27936455 GTATATATCCAGTAATGGGATGG - Intronic
928403229 2:30994282-30994304 CATTCTACTCAGTAATGGGATGG - Intronic
928636849 2:33255467-33255489 GTATATATCCAGTAATGGGATGG - Intronic
929360887 2:41088883-41088905 GTATATATCCAGTAATGGGATGG + Intergenic
929743093 2:44624831-44624853 GTATATACCCAATAATGGGATGG + Intronic
929759416 2:44794560-44794582 GTATATACCCAATAATGGGATGG - Intergenic
930169224 2:48233861-48233883 GTATATATCCAGTAATGGGATGG - Intergenic
930290382 2:49485955-49485977 GTATATATCCAGTAATGGGATGG - Intergenic
931048279 2:58382046-58382068 GTATATATCCAGTAATGGGATGG + Intergenic
931951814 2:67372392-67372414 CATTTGACCCAGTAATGGGATGG + Intergenic
932827119 2:74951685-74951707 GTGTATATCCAATAATGGGATGG - Intergenic
933056658 2:77679209-77679231 CATTTTATTAAATAATTGGAAGG - Intergenic
933060131 2:77726480-77726502 GTATATATCCAGTAATGGGATGG + Intergenic
933257085 2:80093510-80093532 GTATATATCCAGTAATGGGATGG + Intronic
933386589 2:81618808-81618830 GTTTATACCCAGTAATGGGATGG - Intergenic
933680322 2:85094219-85094241 GTATATATCCAGTAATGGGATGG + Intergenic
934063255 2:88316535-88316557 ATTTATACCCAGTAATGGGATGG + Intergenic
935345319 2:102102643-102102665 GAATATACCCAACAATGGGATGG - Intronic
936042818 2:109162732-109162754 GTATATACCCAATAATGGGATGG + Intronic
936690001 2:114875232-114875254 TATTGAATCCCATAATGGGAAGG + Intronic
936805927 2:116332300-116332322 CTATATACCCATTAATGGGATGG + Intergenic
936830746 2:116642915-116642937 GTATATACCCAATAATGGGATGG - Intergenic
937245862 2:120492492-120492514 GTATATATCCAGTAATGGGATGG - Intergenic
937737039 2:125304109-125304131 GTATATACCCAATAATGGGATGG - Intergenic
939013843 2:136878423-136878445 GTATATATCCAGTAATGGGATGG + Intronic
940754976 2:157671687-157671709 GTATATATCCAGTAATGGGATGG + Intergenic
940993333 2:160120152-160120174 GTATATATCCAGTAATGGGATGG - Intronic
941114495 2:161456770-161456792 GTATATATCCAGTAATGGGATGG - Intronic
941302179 2:163816440-163816462 GTATATATCCAGTAATGGGATGG + Intergenic
941410607 2:165152578-165152600 GTATATATCCAGTAATGGGATGG + Intronic
941532895 2:166691416-166691438 GTATATATCCAGTAATGGGATGG - Intergenic
941550341 2:166908120-166908142 GTGTATACCCAATAATGGGATGG + Intronic
941608949 2:167636470-167636492 GTTTATACCCAGTAATGGGATGG - Intergenic
941726928 2:168870842-168870864 GTATATACCCAATAATGGGAGGG - Intronic
942357223 2:175129897-175129919 CATTATATCTTGTAATGGAAAGG - Intronic
942731122 2:179061688-179061710 GTATATATCCAGTAATGGGATGG + Intergenic
942769917 2:179504382-179504404 GTATATATCCAGTAATGGGATGG + Intronic
942906061 2:181182189-181182211 GTATATATCCAGTAATGGGATGG - Intergenic
942918927 2:181347293-181347315 GTATATATCCAGTAATGGGATGG - Intergenic
943392583 2:187288160-187288182 GTATATACCCAATAATGGGATGG + Intergenic
943813507 2:192221158-192221180 GTATATATCCAGTAATGGGATGG + Intergenic
943814665 2:192237490-192237512 GGGTATATCCAGTAATGGGATGG + Intergenic
943873511 2:193033016-193033038 GTATATACCCAATAATGGGATGG + Intergenic
943925096 2:193766243-193766265 GTATATACCCAATAATGGGATGG + Intergenic
944424012 2:199560573-199560595 GTATATATCCAGTAATGGGATGG + Intergenic
945425240 2:209693065-209693087 GATGATATCCCAAAATGGGAAGG + Exonic
945537702 2:211039265-211039287 GTATATACCCAATAATGGGATGG - Intergenic
947043723 2:225953174-225953196 GTATATATCCAGTAATGGGATGG - Intergenic
1169604383 20:7299587-7299609 GTATATACCCAATAATGGGATGG + Intergenic
1169710059 20:8550990-8551012 CATTGTATCCAATAATGTCTGGG + Intronic
1170482434 20:16779726-16779748 GTATATATCCAGTAATGGGATGG + Intergenic
1170503009 20:16994222-16994244 GTATATACCCAATAATGGGATGG - Intergenic
1170980576 20:21208245-21208267 CAATTTTTCCAATAATGGGAGGG + Intronic
1171182657 20:23102371-23102393 CATCATATAAAATAATGGGAGGG - Intergenic
1171224636 20:23431612-23431634 GTATATACCCAATAATGGGATGG - Intergenic
1173270851 20:41533357-41533379 AATGACATCCCATAATGGGATGG - Exonic
1173591196 20:44226286-44226308 TAATATATCCATTAATGGGATGG + Intergenic
1173714974 20:45195744-45195766 GTATATATCCAGTAATGGGATGG + Intergenic
1174902838 20:54518630-54518652 GTATATACCCAATAATGGGATGG + Intronic
1176609196 21:8862667-8862689 ATATATATCCAGTAATGGGATGG + Intergenic
1176716073 21:10350174-10350196 GTATATATCCAGTAATGGGATGG + Intergenic
1177204265 21:17993723-17993745 GAATATATCCAGTAATGGGATGG + Intronic
1177482504 21:21709149-21709171 GTATATATCCAGTAATGGGATGG - Intergenic
1177557581 21:22712774-22712796 CATCAAACCCAATCATGGGAAGG - Intergenic
1177563083 21:22781825-22781847 GTATATATCCAGTAATGGGATGG + Intergenic
1177794722 21:25761891-25761913 TGTTATAACAAATAATGGGAAGG + Intronic
1177889929 21:26792810-26792832 GTATATACCCAATAATGGGATGG + Intergenic
1178056850 21:28809102-28809124 CATAATTTCAAATAATGAGAGGG + Intergenic
1178772256 21:35516619-35516641 GTATATATCCAGTAATGGGATGG - Intronic
1180359291 22:11872498-11872520 ATATATATCCAGTAATGGGATGG + Intergenic
1180520008 22:16189211-16189233 GTATATATCCAGTAATGGGATGG - Intergenic
1180591696 22:16943908-16943930 GTTTATACCCAGTAATGGGATGG - Intergenic
1181340265 22:22173284-22173306 GTATATATCCAATAATGGGATGG + Intergenic
1181664987 22:24388591-24388613 GTATATATCCAGTAATGGGATGG + Intronic
1181832489 22:25572363-25572385 ATATATATCCAGTAATGGGATGG + Intronic
1183874950 22:40772244-40772266 CACTATATCAAGTATTGGGAGGG - Intronic
949145748 3:698068-698090 CTATATACCCAGTAATGGGATGG - Intergenic
949445214 3:4127834-4127856 GATTAGACCCAAAAATGGGAAGG + Intronic
949646551 3:6101649-6101671 GTATATATCCAGTAATGGGATGG + Intergenic
950747639 3:15103111-15103133 CATTAAATCCAATAGTGGGTGGG + Intergenic
950948004 3:16970567-16970589 GTATATACCCAATAATGGGATGG + Intronic
951135261 3:19097834-19097856 GAATATACCCAGTAATGGGATGG + Intergenic
951167788 3:19503413-19503435 GTATATATCCAGTAATGGGATGG - Intronic
951365027 3:21770724-21770746 GAATATACCCAGTAATGGGATGG - Intronic
951442390 3:22738242-22738264 GTATATATCCAGTAATGGGATGG + Intergenic
952016451 3:28962355-28962377 GAGTATACCCAGTAATGGGATGG - Intergenic
952131219 3:30365636-30365658 GTATATATCCAGTAATGGGATGG - Intergenic
952135272 3:30411938-30411960 GTATATATCCAGTAATGGGATGG + Intergenic
952189146 3:31003763-31003785 CAGTATATCAAATATTGGTAAGG - Intergenic
952700888 3:36326573-36326595 GTATATATCCAGTAATGGGATGG - Intergenic
952747844 3:36798443-36798465 GTATATATCCAGTAATGGGATGG + Intergenic
953305973 3:41829781-41829803 CTATATACCCAGTAATGGGATGG - Intronic
955538813 3:59952606-59952628 CTTAATACCCTATAATGGGAGGG - Intronic
956032958 3:65059359-65059381 GAATATACCCAGTAATGGGATGG - Intergenic
956222493 3:66919405-66919427 GTATATACCCAATAATGGGATGG - Intergenic
956349427 3:68318356-68318378 CATTATATGCAGAAATTGGAAGG + Intronic
956991116 3:74766854-74766876 CCTTACAACCAAAAATGGGAAGG + Intergenic
957101315 3:75832267-75832289 GAATATACCCAGTAATGGGATGG + Intergenic
957480069 3:80781222-80781244 GTATATACCCAATAATGGGATGG + Intergenic
957606214 3:82402943-82402965 GTTTATACCCAGTAATGGGATGG - Intergenic
957688586 3:83537706-83537728 GTATATATCCAGTAATGGGATGG - Intergenic
957709008 3:83829211-83829233 TCTTATATCCAAAAATGGGATGG + Intergenic
957752409 3:84438739-84438761 AATTTTACCCAGTAATGGGATGG + Intergenic
958170929 3:89939590-89939612 GTATATATCCAGTAATGGGATGG + Intergenic
958198691 3:90279121-90279143 GTATATACCCAATAATGGGATGG + Intergenic
958200375 3:90307583-90307605 GTATATATCCAGTAATGGGATGG + Intergenic
958496603 3:94851510-94851532 GTATATACCCAATAATGGGATGG - Intergenic
958822137 3:98987851-98987873 GTATATATCCAGTAATGGGATGG - Intergenic
958844154 3:99245199-99245221 GTATATATCCAATAATGGGATGG - Intergenic
958971544 3:100616305-100616327 TGTTATATCCAATTCTGGGAGGG - Intronic
959409339 3:106000646-106000668 GATTATAGACAATGATGGGAAGG + Intergenic
960330467 3:116353729-116353751 CATTATATTAAAATATGGGATGG - Intronic
960691556 3:120351161-120351183 CATTATATAGAATAAAGGAAAGG + Intergenic
960772480 3:121209939-121209961 GTATATACCCAATAATGGGATGG + Intronic
962206261 3:133437111-133437133 GTATATATCCAGTAATGGGATGG + Intronic
962628576 3:137252133-137252155 GTATATATCCAGTAATGGGATGG - Intergenic
963421492 3:145066115-145066137 GTATATACCCAATAATGGGATGG - Intergenic
963953929 3:151232421-151232443 GTTTATACCCAGTAATGGGATGG - Intronic
963977384 3:151496684-151496706 GTATATATCCAGTAATGGGATGG + Intergenic
963979001 3:151515103-151515125 GTATATATCCAGTAATGGGATGG - Intergenic
964839111 3:160974377-160974399 GTGTATATCCAGTAATGGGATGG + Intronic
964947562 3:162244642-162244664 GTATATACCCAATAATGGGATGG + Intergenic
965032684 3:163392872-163392894 GAATATACCCAGTAATGGGATGG - Intergenic
965039305 3:163485594-163485616 CTATATACCCAGTAATGGGATGG - Intergenic
965057525 3:163741857-163741879 GAATATACCCAGTAATGGGATGG - Intergenic
965217549 3:165882562-165882584 GTATATACCCAATAATGGGATGG - Intergenic
965295397 3:166938920-166938942 CTATATATCCAATAATAGGATGG + Intergenic
965659093 3:171021857-171021879 CTTTATAGCCAGTAATGGGCAGG + Intronic
966156799 3:176925406-176925428 GTTTATAGCCAGTAATGGGATGG - Intergenic
966456378 3:180120694-180120716 GTTTATACCCAGTAATGGGATGG + Intergenic
969168957 4:5343456-5343478 CTATATACCCAGTAATGGGATGG + Intronic
969808632 4:9630681-9630703 GTATATATCCAGTAATGGGATGG - Intergenic
969910438 4:10439738-10439760 AATTAGATGCAATGATGGGATGG - Intergenic
970623474 4:17850763-17850785 GTATATATCCAGTAATGGGATGG - Intronic
970990396 4:22206981-22207003 GAATATACCCAGTAATGGGATGG + Intergenic
971493735 4:27241597-27241619 GTATATATCCAGTAATGGGATGG - Intergenic
972372613 4:38439281-38439303 GTATATACCCAATAATGGGATGG - Intergenic
972372963 4:38443294-38443316 GTATATACCCAATAATGGGATGG + Intergenic
972839650 4:42915246-42915268 CATCATAGCAAAGAATGGGATGG + Intronic
972864180 4:43210104-43210126 GTTTATAGCCAGTAATGGGATGG - Intergenic
973069505 4:45839466-45839488 CTATATACCCAGTAATGGGATGG - Intergenic
973288240 4:48443522-48443544 GTTTATACCCAGTAATGGGATGG + Intergenic
973848834 4:54940860-54940882 CATTATACCCAATTATCAGATGG - Intergenic
974121505 4:57644088-57644110 TTATATATCCAGTAATGGGATGG + Intergenic
974123125 4:57663782-57663804 GTATATATCCAGTAATGGGATGG + Intergenic
974166399 4:58210053-58210075 CATTATATCTAATGATAGAAGGG + Intergenic
974952103 4:68595771-68595793 GTATATATCCAGTAATGGGATGG - Intronic
976859560 4:89646885-89646907 GTATATATCCAGTAATGGGATGG + Intergenic
977161244 4:93638814-93638836 GTATATATCCAGTAATGGGATGG + Intronic
977537211 4:98267853-98267875 AAATATACCCAGTAATGGGATGG + Intronic
977900292 4:102414768-102414790 GTATATATCCAGTAATGGGATGG - Intronic
978272061 4:106902978-106903000 GTTTATATCCAGTAATGGGATGG - Intergenic
978393335 4:108250854-108250876 GTATATACCCAATAATGGGATGG - Intergenic
978734493 4:112070177-112070199 GTATATATCCAGTAATGGGATGG - Intergenic
978997758 4:115177353-115177375 GTATATACCCAATAATGGGATGG - Intergenic
979117730 4:116848908-116848930 TATAATACCCAGTAATGGGATGG + Intergenic
979371028 4:119886594-119886616 GTATATATCCAGTAATGGGATGG + Intergenic
979729645 4:124008891-124008913 GTATATACCCAATAATGGGATGG + Intergenic
980008440 4:127567624-127567646 CATTTTATCCCATAATGTGATGG + Intergenic
980499311 4:133628183-133628205 GTATATATCCAGTAATGGGATGG + Intergenic
981852115 4:149243050-149243072 GTATATATCCAGTAATGGGATGG + Intergenic
982504734 4:156203150-156203172 CTTTTTATCCAATAATTGAATGG - Intergenic
982641168 4:157963491-157963513 GTATATATCCAGTAATGGGATGG - Intergenic
982838324 4:160151671-160151693 GTATATATCCAGTAATGGGATGG + Intergenic
982940774 4:161551089-161551111 GTATATATCCAGTAATGGGATGG + Intronic
982975297 4:162048903-162048925 CAGTATATCCTATAAGGTGAGGG + Intronic
983832456 4:172345007-172345029 CATCATATCTAATAATAGCAGGG - Intronic
984849278 4:184139863-184139885 GTATATATCCAGTAATGGGACGG + Intronic
984959424 4:185080896-185080918 CATTTTATCCAATACAGTGAAGG - Intergenic
985311226 4:188601787-188601809 CATTGCATCCAATGTTGGGAAGG - Intergenic
1202770048 4_GL000008v2_random:195857-195879 ATATATATCCAGTAATGGGATGG - Intergenic
986102003 5:4620909-4620931 CTATATACCCAGTAATGGGATGG - Intergenic
986549012 5:8932135-8932157 CCATATACCCAGTAATGGGATGG - Intergenic
986555158 5:9002977-9002999 CTATATACCCAGTAATGGGATGG + Intergenic
986871913 5:12058690-12058712 CTATATACCCAGTAATGGGATGG - Intergenic
986943940 5:12991676-12991698 GTATATATCCAGTAATGGGATGG - Intergenic
987172867 5:15276896-15276918 GTATATACCCAATAATGGGATGG - Intergenic
987523428 5:19017260-19017282 CCTTATACCCAGTAATGGGATGG - Intergenic
987693267 5:21295966-21295988 GTATATATCCAGTAATGGGATGG - Intergenic
988082196 5:26428638-26428660 CTATATACCCAGTAATGGGATGG + Intergenic
988644137 5:33075285-33075307 CATTATATCCAAAAACTTGAAGG + Intergenic
989363470 5:40629784-40629806 GTATATATCCAGTAATGGGATGG + Intergenic
989560514 5:42844815-42844837 GTATATATCCAGTAATGGGATGG + Intronic
989660960 5:43797250-43797272 ATATATATCCAGTAATGGGATGG - Intergenic
989785139 5:45318050-45318072 GTATATACCCAATAATGGGATGG - Intronic
989789457 5:45379127-45379149 GTATATAACCAATAATGGGATGG + Intronic
989832658 5:45939899-45939921 CTATATACCCAGTAATGGGATGG + Intergenic
989954068 5:50335710-50335732 GTATATATCCAGTAATGGGATGG - Intergenic
990065025 5:51701714-51701736 GTATATATCCAGTAATGGGATGG - Intergenic
990104969 5:52247222-52247244 GTATATATCCAGTAATGGGATGG + Intergenic
990397874 5:55402752-55402774 CATTATAGACAATGATGGGGAGG - Intronic
990654876 5:57943856-57943878 GTATATATCCAGTAATGGGATGG + Intergenic
990750961 5:59015759-59015781 ATATATATCCAGTAATGGGATGG - Intronic
991321235 5:65375746-65375768 GTATATATCCAGTAATGGGATGG - Intronic
991539385 5:67709610-67709632 GTATATATCCAGTAATGGGATGG - Intergenic
991628126 5:68626067-68626089 GTATATATCCAGTAATGGGATGG - Intergenic
991747012 5:69753590-69753612 GTATATATCCAGTAATGGGATGG + Intergenic
991750693 5:69801652-69801674 GTATATATCCAGTAATGGGATGG - Intergenic
991798614 5:70333532-70333554 GTATATATCCAGTAATGGGATGG + Intergenic
991826388 5:70628902-70628924 GTATATATCCAGTAATGGGATGG + Intergenic
991829981 5:70676549-70676571 GTATATATCCAGTAATGGGATGG - Intergenic
991890945 5:71332855-71332877 GTATATATCCAGTAATGGGATGG + Intergenic
992601199 5:78402322-78402344 AATTATATCCAATCAACGGATGG + Intronic
992949652 5:81845955-81845977 CCTTATATCCACTGTTGGGATGG + Intergenic
992958353 5:81933528-81933550 GTATATATCCAGTAATGGGATGG + Intergenic
993142877 5:84055945-84055967 GTATATATCCAGTAATGGGATGG - Intronic
993702141 5:91131125-91131147 GCTTATACCCAGTAATGGGATGG + Intronic
993804558 5:92388346-92388368 GTATATATCCAGTAATGGGATGG - Intergenic
993818599 5:92584782-92584804 GTATATATCCAGTAATGGGATGG - Intergenic
993861073 5:93137713-93137735 GAATATACCCAGTAATGGGATGG + Intergenic
993879602 5:93347213-93347235 GCATATACCCAATAATGGGATGG + Intergenic
994159679 5:96543018-96543040 GTATATATCCAGTAATGGGATGG - Intronic
994868677 5:105315632-105315654 GTATATACCCAATAATGGGATGG + Intergenic
995069877 5:107907930-107907952 GTATATATCCAGTAATGGGATGG - Intronic
995178651 5:109209010-109209032 GTATATACCCAATAATGGGATGG + Intergenic
995302326 5:110598496-110598518 GTATATATCCAGTAATGGGATGG - Intronic
995692505 5:114843428-114843450 GTATATATCCAGTAATGGGATGG - Intergenic
995697095 5:114891760-114891782 GTATATATCCAGTAATGGGATGG + Intergenic
996120590 5:119667362-119667384 GTATATATCCAGTAATGGGATGG + Intergenic
996170182 5:120280817-120280839 GTTTATACCCAGTAATGGGATGG + Intergenic
996348189 5:122510120-122510142 GTATATACCCAATAATGGGATGG + Intergenic
996709435 5:126529577-126529599 GTATATATCCAGTAATGGGATGG - Intergenic
998627000 5:143857689-143857711 GTATATATCCAGTAATGGGATGG - Intergenic
998892464 5:146761149-146761171 GTATATATCCAGTAATGGGATGG - Intronic
999012635 5:148059341-148059363 CATTTTATCTAATAATAGAATGG - Intronic
999196972 5:149788561-149788583 GCATATATCCAGTAATGGGATGG - Intronic
999415309 5:151389915-151389937 TATTATACCCAGTAATGGGATGG + Intergenic
999518078 5:152320985-152321007 GTATATACCCAATAATGGGATGG - Intergenic
999540959 5:152572242-152572264 GTATATATCCAGTAATGGGATGG - Intergenic
999634233 5:153603429-153603451 CTATATACCCAGTAATGGGATGG + Intronic
999647434 5:153732294-153732316 CATTACAGCAAATAATGTGAAGG - Intronic
1000553114 5:162691271-162691293 GTATATATCCAGTAATGGGATGG + Intergenic
1003782916 6:9449354-9449376 GTATATACCCAATAATGGGATGG - Intergenic
1004465471 6:15881178-15881200 GTATAGATCCAATAATGGGATGG + Intergenic
1004889050 6:20080726-20080748 GTATATACCCAATAATGGGATGG - Intergenic
1005551327 6:26919674-26919696 GTATATACCCAATAATGGGATGG - Intergenic
1006024126 6:31136655-31136677 CACTATATTAAAGAATGGGAAGG - Intronic
1006283718 6:33077424-33077446 GTATATATCCAGTAATGGGATGG + Intronic
1007137698 6:39538702-39538724 GTATATACCCAATAATGGGATGG - Intronic
1007328656 6:41085073-41085095 CATTATATCCACTGTTAGGATGG + Intronic
1008051295 6:46902766-46902788 CATTATCTCCAATGATTGTAGGG - Intronic
1008291802 6:49724774-49724796 GTATATACCCAATAATGGGATGG - Intergenic
1009219615 6:60967699-60967721 GTATATATCCAGTAATGGGATGG - Intergenic
1009226167 6:61021887-61021909 GTATATATCCAGTAATGGGATGG + Intergenic
1009226325 6:61023569-61023591 AAATATACCCAGTAATGGGATGG - Intergenic
1009647651 6:66427113-66427135 GTGTATATCCAGTAATGGGATGG - Intergenic
1009776184 6:68208809-68208831 GTATATATCCAATAATGGGATGG - Intergenic
1010086748 6:71928385-71928407 CATTATTTCAAATAATGACAAGG - Intronic
1010129558 6:72475059-72475081 GTATATATCCAGTAATGGGATGG - Intergenic
1010279495 6:74007674-74007696 ATATATATCCAGTAATGGGATGG + Intergenic
1010460967 6:76113881-76113903 GTATATACCCAATAATGGGATGG + Intergenic
1010487800 6:76436377-76436399 GTATATATCCAGTAATGGGATGG - Intergenic
1010535880 6:77029569-77029591 GTATATACCCAATAATGGGATGG + Intergenic
1010598115 6:77789890-77789912 GTATATATCCAGTAATGGGATGG - Intronic
1010730955 6:79390817-79390839 GTATATACCCAATAATGGGATGG - Intergenic
1010876399 6:81112564-81112586 GTTTATACCCAGTAATGGGATGG + Intergenic
1010899607 6:81409794-81409816 CTATATACCCAGTAATGGGATGG - Intergenic
1010908371 6:81521237-81521259 GAATATACCCAGTAATGGGATGG + Intronic
1011058669 6:83236246-83236268 CATTATTTACAATAATGATATGG - Intronic
1011298435 6:85848394-85848416 GTATATATCCAGTAATGGGATGG + Intergenic
1011418253 6:87145237-87145259 GTATATATCCAGTAATGGGATGG - Intergenic
1011534195 6:88358009-88358031 GTATATATCCAGTAATGGGATGG - Intergenic
1011748804 6:90434657-90434679 CATTATAGCCCATAATGGACAGG + Intergenic
1012332344 6:98008638-98008660 GTATATACCCAATAATGGGATGG + Intergenic
1012479821 6:99654040-99654062 GTATATATCCAGTAATGGGATGG + Intergenic
1013389384 6:109667908-109667930 CTATATACCCAGTAATGGGATGG + Intronic
1013882610 6:114923688-114923710 TTATATACCCAATAATGGGATGG + Intergenic
1013949505 6:115762931-115762953 ATATATATCCAGTAATGGGATGG - Intergenic
1014364179 6:120519882-120519904 GTATATACCCAATAATGGGATGG + Intergenic
1014580374 6:123129502-123129524 GTATATATCCAGTAATGGGATGG - Intergenic
1014603575 6:123445871-123445893 GTATATATCCAGTAATGGGATGG - Intronic
1016106054 6:140163766-140163788 GTATATATCCAGTAATGGGATGG - Intergenic
1016169337 6:140990087-140990109 GTATATATCCAGTAATGGGATGG + Intergenic
1016454174 6:144214392-144214414 CATTCCATCTATTAATGGGAGGG + Intergenic
1016610273 6:145981167-145981189 GTATATATCCAGTAATGGGATGG + Intergenic
1016611478 6:145995274-145995296 GTATATATCCAGTAATGGGATGG + Intergenic
1016661020 6:146580078-146580100 GTATATATCCAGTAATGGGATGG + Intergenic
1017281206 6:152628148-152628170 AATTATAGCCCAGAATGGGATGG - Intronic
1017887935 6:158614993-158615015 GTATATATCCAGTAATGGGATGG + Intronic
1017977014 6:159367120-159367142 GTATATATCCAGTAATGGGATGG - Intergenic
1018213554 6:161505030-161505052 GTGTATATCCAGTAATGGGATGG + Intronic
1020396302 7:7722351-7722373 GATTAGACCCAATAATGCGAAGG + Intronic
1020425362 7:8060212-8060234 CATTAAAGAAAATAATGGGAAGG + Exonic
1020852885 7:13378969-13378991 GTATATATCCAGTAATGGGATGG - Intergenic
1021047920 7:15945731-15945753 GTATATATCCAGTAATGGGATGG - Intergenic
1021427305 7:20516394-20516416 GAATATACCCAGTAATGGGATGG - Intergenic
1021671066 7:23035570-23035592 CTATATACCCAGTAATGGGATGG - Intergenic
1022047444 7:26633345-26633367 GTATATATCCAGTAATGGGATGG + Intergenic
1022070116 7:26904664-26904686 GTATATACCCAATAATGGGATGG - Intronic
1022130598 7:27401258-27401280 GTATATACCCAATAATGGGATGG + Intergenic
1022558434 7:31324518-31324540 GTATATACCCAATAATGGGATGG - Intergenic
1023016501 7:35972877-35972899 CCTTATGTCCAATAATTGGGGGG - Intergenic
1024106291 7:46090340-46090362 GTGTATATTCAATAATGGGATGG + Intergenic
1025578016 7:62672478-62672500 GTATATATCCAGTAATGGGAAGG - Intergenic
1025581821 7:62729102-62729124 GTATATATCCAGTAATGGGATGG + Intergenic
1025597729 7:62952066-62952088 GTATATACCCAATAATGGGATGG - Intergenic
1027767764 7:82366729-82366751 ATATATATCCAGTAATGGGATGG + Intronic
1027834453 7:83222602-83222624 GTTTATACCCAGTAATGGGATGG + Intergenic
1028209040 7:88051186-88051208 GTATATATCCAGTAATGGGATGG - Intronic
1028394327 7:90350408-90350430 GTATATATCCAGTAATGGGATGG + Intronic
1029778839 7:102709839-102709861 GTATATATCCAGTAATGGGATGG + Intergenic
1030483365 7:110132707-110132729 GTTTATACCCAGTAATGGGATGG + Intergenic
1030774275 7:113514179-113514201 GTATATATCCAGTAATGGGATGG + Intergenic
1030804456 7:113898013-113898035 CATTATAGTCAATACTTGGAAGG + Intronic
1031001569 7:116421489-116421511 CAATATTTACAATAATGAGATGG + Intronic
1031144698 7:117985032-117985054 GTATATACCCAATAATGGGATGG - Intergenic
1031245019 7:119300532-119300554 CATTTGACCCAGTAATGGGATGG + Intergenic
1031314092 7:120235332-120235354 GTATATATCCAGTAATGGGATGG + Intergenic
1031578687 7:123445693-123445715 TATTATACCCAGTAATGGGATGG + Intergenic
1031584979 7:123523209-123523231 AAATATACCCAGTAATGGGATGG + Intronic
1031699543 7:124906124-124906146 CTATATACCCAGTAATGGGATGG - Intronic
1031801894 7:126257281-126257303 CATTCTATCCTAGAATGGAATGG - Intergenic
1032857628 7:135848538-135848560 GTATATACCCAATAATGGGATGG + Intergenic
1033908287 7:146233971-146233993 GAATATACCCAGTAATGGGATGG + Intronic
1036995425 8:13649944-13649966 TATTATACCTAGTAATGGGATGG + Intergenic
1037228711 8:16627711-16627733 CACTATTTCCAATAAAGGCATGG - Intergenic
1037496067 8:19442204-19442226 GTATATATCCAGTAATGGGATGG - Intronic
1038225705 8:25655442-25655464 GTATATACCCAATAATGGGATGG + Intergenic
1038365952 8:26935441-26935463 GTATATACCCAATAATGGGATGG + Intergenic
1038929467 8:32176963-32176985 GAATATACCCAGTAATGGGATGG - Intronic
1039155086 8:34545865-34545887 GTATATATCCAGTAATGGGATGG - Intergenic
1039275064 8:35926254-35926276 CATCATATCCAAGAATGGTGGGG - Intergenic
1039611392 8:38922147-38922169 CATTATCAGCAATAATGGCAGGG - Intronic
1039766108 8:40629912-40629934 GTATATATCCAGTAATGGGATGG + Intronic
1040321628 8:46311767-46311789 GTTTATACCCAGTAATGGGATGG - Intergenic
1040521910 8:48184535-48184557 GTATATACCCAATAATGGGATGG - Intergenic
1040867648 8:52066049-52066071 GTATATATCCAGTAATGGGATGG + Intergenic
1041046557 8:53892478-53892500 GTATATACCCAATAATGGGATGG - Intronic
1041384962 8:57291431-57291453 GTTTATACCCAGTAATGGGATGG + Intergenic
1041698314 8:60760977-60760999 GTATATATCCAGTAATGGGATGG - Intronic
1042073390 8:64961189-64961211 GTATATATCCAGTAATGGGATGG - Intergenic
1042746592 8:72114528-72114550 CTTTATTTCCAACAATGAGATGG + Intronic
1043315919 8:78921917-78921939 CCTGATATACAATAATTGGAGGG - Intergenic
1044131777 8:88532569-88532591 GTATATATCCAGTAATGGGATGG + Intergenic
1044453410 8:92364698-92364720 GTATATATCCAGTAATGGGATGG + Intergenic
1044454871 8:92381927-92381949 GTATATATCCAGTAATGGGATGG + Intergenic
1044482241 8:92704911-92704933 ATATATACCCAATAATGGGATGG - Intergenic
1045761961 8:105620037-105620059 GTATATATCCAGTAATGGGATGG + Intronic
1046246908 8:111575648-111575670 GTATATATCCAGTAATGGGATGG + Intergenic
1046327552 8:112669804-112669826 CATTATATAAAATAATCTGAGGG - Intronic
1046383282 8:113477159-113477181 GTATATATCCAGTAATGGGATGG + Intergenic
1046554542 8:115758648-115758670 GTATATACCCAATAATGGGATGG - Intronic
1046610293 8:116415942-116415964 ATTTATACCCAGTAATGGGATGG - Intergenic
1047736465 8:127769659-127769681 GTATATATCCAGTAATGGGATGG + Intergenic
1047940631 8:129824849-129824871 TATTCTATCCAATAGTGGGTGGG - Intergenic
1048093493 8:131265941-131265963 ATATATATCCAGTAATGGGATGG - Intergenic
1048229007 8:132618933-132618955 GTATATATCCAGTAATGGGATGG - Intronic
1048864693 8:138751099-138751121 TATGATATTCAATAATGGCATGG + Intronic
1050451221 9:5783433-5783455 GTATATATCCAGTAATGGGATGG - Intronic
1050578427 9:7024839-7024861 GTATATATCCAGTAATGGGATGG + Intronic
1050737382 9:8779484-8779506 CATTCTTTCTAATAATTGGAAGG - Intronic
1050769557 9:9180082-9180104 GTATATATCCAGTAATGGGATGG - Intronic
1051676780 9:19566597-19566619 GCATATATCCAGTAATGGGATGG - Intronic
1051718608 9:20011115-20011137 GTATATATCCAGTAATGGGATGG + Intergenic
1052430009 9:28353638-28353660 GTATATATCCAGTAATGGGATGG - Intronic
1052439860 9:28482129-28482151 GTATATATCCAGTAATGGGATGG + Intronic
1052714983 9:32104110-32104132 GAATATACCCAGTAATGGGATGG - Intergenic
1052716457 9:32123999-32124021 GAATATACCCAGTAATGGGATGG - Intergenic
1054358800 9:64092218-64092240 GTATATATCCAGTAATGGGATGG - Intergenic
1054980208 9:71197376-71197398 GTATATACCCAATAATGGGATGG + Intronic
1054980905 9:71204698-71204720 GTATATACCCAATAATGGGATGG - Intronic
1055012344 9:71580588-71580610 CATTTTTTTCAGTAATGGGATGG + Intergenic
1055014516 9:71601463-71601485 GTATATATCCAGTAATGGGATGG - Intergenic
1055540486 9:77299559-77299581 GTATATACCCAATAATGGGATGG - Intronic
1056095954 9:83253750-83253772 GTATATACCCAATAATGGGATGG - Intronic
1056845632 9:90035372-90035394 CATTAAATCCTATAAGAGGAGGG - Intergenic
1058588735 9:106538274-106538296 TTATATATCCAGTAATGGGATGG + Intergenic
1059078722 9:111223991-111224013 CTGTATATCCAGTAATGGGATGG - Intergenic
1060324247 9:122597177-122597199 CTATATACCCAGTAATGGGATGG + Intergenic
1203694946 Un_GL000214v1:89534-89556 ATATATATCCAGTAATGGGATGG - Intergenic
1203491603 Un_GL000224v1:111489-111511 GTATATACCCAATAATGGGATGG + Intergenic
1203504227 Un_KI270741v1:53360-53382 GTATATACCCAATAATGGGATGG + Intergenic
1203704600 Un_KI270742v1:27900-27922 ATATATATCCAGTAATGGGATGG + Intergenic
1203559402 Un_KI270744v1:37913-37935 ATATATATCCAGTAATGGGATGG - Intergenic
1203641327 Un_KI270751v1:14529-14551 ATATATATCCAGTAATGGGATGG + Intergenic
1185497663 X:567639-567661 GTATATATCCAGTAATGGGATGG + Intergenic
1186765446 X:12766118-12766140 GTATATATCCAGTAATGGGATGG - Intergenic
1187635408 X:21222641-21222663 GTGTATATCCAGTAATGGGATGG + Intergenic
1187635995 X:21228951-21228973 GTATATACCCAATAATGGGATGG + Intergenic
1188110005 X:26185829-26185851 GTATATATCCAGTAATGGGATGG - Intergenic
1188256152 X:27964054-27964076 GTATATACCCAATAATGGGATGG + Intergenic
1188719973 X:33510351-33510373 GAATATAGCCAGTAATGGGATGG - Intergenic
1188775646 X:34215409-34215431 GAATATACCCAATAGTGGGATGG - Intergenic
1188951200 X:36377129-36377151 GTATATATCCAGTAATGGGATGG + Intronic
1189084141 X:38002371-38002393 GTATATATCCAGTAATGGGATGG + Intronic
1189171165 X:38911125-38911147 GTATATATCCAGTAATGGGATGG - Intergenic
1189255517 X:39635616-39635638 GTATATATCCAGTAATGGGATGG - Intergenic
1189998349 X:46660856-46660878 GTATATACCCAATAATGGGATGG - Intronic
1190067613 X:47252510-47252532 GTATATACCCAATAATGGGATGG + Intergenic
1190122047 X:47669718-47669740 GTATATACCCAATAATGGGATGG + Intergenic
1190375047 X:49780957-49780979 GAATATACCCAGTAATGGGATGG - Intergenic
1190544628 X:51512823-51512845 GTATATATCCAGTAATGGGATGG + Intergenic
1190624380 X:52322548-52322570 CTATATACCCAGTAATGGGATGG - Intergenic
1190900254 X:54665339-54665361 GTATATATCCAGTAATGGGATGG + Intergenic
1191064770 X:56336151-56336173 GTATATATCCAGTAATGGGATGG + Intergenic
1191069839 X:56388987-56389009 ATATATATCCATTAATGGGATGG + Intergenic
1191091676 X:56630081-56630103 GAATATACCCAGTAATGGGATGG + Intergenic
1191160352 X:57323339-57323361 GTATATATCCAGTAATGGGATGG + Intronic
1191585785 X:62825220-62825242 GTATATATCCAGTAATGGGATGG - Intergenic
1191590603 X:62880090-62880112 GTATATATCCAGTAATGGGATGG + Intergenic
1191617501 X:63185087-63185109 GTATATATCCAGTAATGGGATGG - Intergenic
1191618797 X:63193836-63193858 GTATATATCCAGTAATGGGATGG + Intergenic
1191658343 X:63624017-63624039 GTATATACCCAATAATGGGATGG - Intergenic
1191994809 X:67081819-67081841 GTATATACCCAATAATGGGATGG - Intergenic
1192048804 X:67704151-67704173 GTATATACCCAATAATGGGATGG + Intronic
1192064817 X:67871874-67871896 GTATATATCCAGTAATGGGACGG - Intergenic
1192065884 X:67884453-67884475 GTATATATCCAGTAATGGGATGG + Intergenic
1192392968 X:70750408-70750430 CTATATACCCAGTAATGGGATGG - Intronic
1192685460 X:73300135-73300157 GAATATACCCAGTAATGGGATGG + Intergenic
1192689430 X:73346401-73346423 AATAATACCCAATAATGAGATGG + Intergenic
1192713036 X:73611525-73611547 GTATATACCCAATAATGGGATGG + Intronic
1192834976 X:74789480-74789502 GTATATATCCAGTAATGGGATGG + Intronic
1192956332 X:76074302-76074324 GTATATATCCAGTAATGGGATGG - Intergenic
1193010261 X:76667740-76667762 GTATATATCCAGTAATGGGATGG - Intergenic
1193034855 X:76938327-76938349 GTATATATCCAGTAATGGGATGG + Intergenic
1193127273 X:77883256-77883278 GTGTATATCCAGTAATGGGATGG + Intronic
1193235266 X:79099081-79099103 TATTTTATCCAATCATGGGTTGG - Intergenic
1193919984 X:87413256-87413278 GTATATATCCAGTAATGGGATGG + Intergenic
1194482124 X:94439501-94439523 GTATATATCCAGTAATGGGATGG + Intergenic
1195214595 X:102686389-102686411 GTATATATCCAGTAATGGGATGG + Intergenic
1195241100 X:102952943-102952965 GTATATACCCAATAATGGGATGG + Intergenic
1195424938 X:104718110-104718132 GTATATACCCAATAATGGGATGG + Intronic
1195550673 X:106166004-106166026 GTATATATCCAGTAATGGGATGG + Intergenic
1195665590 X:107427341-107427363 GTATATATCCAGTAATGGGATGG - Intergenic
1195733189 X:107986584-107986606 CTATATACCCAGTAATGGGATGG + Intergenic
1195827329 X:109016311-109016333 GTATATACCCAATAATGGGATGG - Intergenic
1195833123 X:109082695-109082717 TTCTATACCCAATAATGGGATGG + Intergenic
1195978263 X:110551281-110551303 GTATATATCCAGTAATGGGATGG - Intergenic
1196065420 X:111458909-111458931 AATTATATCCAAATATAGGAGGG + Intergenic
1196239553 X:113325938-113325960 GTTTATACCCAGTAATGGGATGG - Intergenic
1196243965 X:113376311-113376333 CATTATATACAATACTGATATGG - Intergenic
1196251702 X:113468500-113468522 GTATATATCCAGTAATGGGATGG - Intergenic
1196471410 X:116032771-116032793 GTATATATCCAGTAATGGGATGG + Intergenic
1196635610 X:117999178-117999200 GTATATACCCAATAATGGGATGG - Intronic
1197073973 X:122333674-122333696 GTATATATCCAGTAATGGGATGG - Intergenic
1197447255 X:126565667-126565689 GTTTATACCCAGTAATGGGATGG - Intergenic
1197465952 X:126804825-126804847 GTATATACCCAATAATGGGATGG - Intergenic
1197949201 X:131875839-131875861 GTATATACCCAATAATGGGATGG - Intergenic
1197952537 X:131913278-131913300 GTATATACCCAATAATGGGATGG + Intergenic
1197960133 X:131995125-131995147 GTATATACCCAATAATGGGATGG - Intergenic
1198345853 X:135758304-135758326 GTATATATCCAGTAATGGGATGG - Intergenic
1198487571 X:137103665-137103687 GTATATATCCAGTAATGGGATGG + Intergenic
1198713321 X:139529172-139529194 GTATATACCCAATAATGGGATGG - Intergenic
1198824717 X:140687304-140687326 CATAAAATACAATAATTGGATGG - Intergenic
1199221824 X:145325341-145325363 GTTTATACCCAGTAATGGGATGG - Intergenic
1200008667 X:153105305-153105327 CACTATCTCCAGTGATGGGAGGG - Intergenic
1200580332 Y:4942026-4942048 GTATATATCCAGTAATGGGATGG - Intergenic
1200815440 Y:7526840-7526862 GTATATACCCAATAATGGGATGG - Intergenic
1201245375 Y:11998088-11998110 GTATATAACCAATAATGGGATGG + Intergenic
1201493774 Y:14571103-14571125 GTTTATACCCAGTAATGGGATGG + Intronic
1201990605 Y:20020719-20020741 GTATATATCCAGTAATGGGATGG - Intergenic
1202075229 Y:21030953-21030975 GTATATATCCAGTAATGGGATGG - Intergenic
1202189566 Y:22227448-22227470 GTATATATCCAGTAATGGGACGG + Intergenic