ID: 1070159295

View in Genome Browser
Species Human (GRCh38)
Location 10:73856058-73856080
Sequence CAGAATCTGATGGGGTGCGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 249
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 233}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070159295 Original CRISPR CAGAATCTGATGGGGTGCGG TGG (reversed) Intronic
901399109 1:9004072-9004094 AAGAATCTGGTTGGGTGCTGTGG + Intronic
901819207 1:11815680-11815702 CAGAATCTGGCTGGGTGCGGTGG - Intronic
901989179 1:13098473-13098495 CAGAAACTGACCGGGTGCTGTGG + Intergenic
901992634 1:13128294-13128316 CAGAAACTGACCGGGTGCTGTGG - Intergenic
902550650 1:17217182-17217204 CAGAACTTGTTGGGGTGGGGCGG + Intronic
904340195 1:29829337-29829359 GAGAATCTCATGGGGAGAGGAGG - Intergenic
905938094 1:41840711-41840733 CAGGATCTGATGGGCTCCGTGGG - Intronic
906235529 1:44205799-44205821 CAGAATTTGATGGGGGGTGGGGG + Intergenic
907480907 1:54744998-54745020 CTGATCCTGATGGGGTGTGGGGG + Intergenic
908477826 1:64506071-64506093 CAAAATCCGATGGTGTGTGGAGG + Intronic
910405309 1:86882836-86882858 CAGATTCTGACTGGGTGCAGTGG + Intronic
912384951 1:109266696-109266718 CAAAATGTGGTGGGGTGCAGTGG - Intronic
912933998 1:113986994-113987016 CAGGCTCTGATGGGGTGAGACGG - Intergenic
913457244 1:119045892-119045914 CAGAATCTGGTGGGGTATTGTGG - Intronic
914205000 1:145519068-145519090 CAGGAGCTGATGGGGTGGGAGGG - Intergenic
914484119 1:148092250-148092272 CAGGAGCTGATGGGGTGGGAGGG - Intergenic
915973493 1:160370410-160370432 CAGAAACTGGTGGGGGTCGGGGG - Intronic
916215926 1:162394651-162394673 GAGACTCTGGTGGGGTGGGGTGG - Intergenic
917241694 1:172955708-172955730 AATAGTCTGATGGGGTGGGGAGG + Intergenic
918093372 1:181316052-181316074 CAGAATCTGCTGGAGCTCGGGGG - Intergenic
918994783 1:191743356-191743378 CAGAATAAAATGGGGTGGGGGGG - Intergenic
919027130 1:192187558-192187580 TAGCATCTGATGAGGTGGGGCGG - Intergenic
919812094 1:201415132-201415154 CAGACTCTGAAGGGATGTGGAGG - Intronic
922063208 1:222111312-222111334 CAGAATTTAAAGGGGTGTGGGGG - Intergenic
923518926 1:234721077-234721099 CAGAATCGGATGAGATGGGGTGG + Intergenic
1062795202 10:339913-339935 AAAAATCTGACTGGGTGCGGTGG + Intronic
1062958970 10:1558545-1558567 CAGATTTAGATGGGGTGCGTGGG - Intronic
1063235284 10:4108192-4108214 CAGAATCTGTTTGGGAGCAGAGG + Intergenic
1063484363 10:6405268-6405290 CAGAATCTGACCGGGCGCGGTGG - Intergenic
1063724392 10:8620985-8621007 CAAAGTGTGATGGGGTGAGGTGG + Intergenic
1066545750 10:36498342-36498364 CAAAATCTCATCGGGTGTGGTGG + Intergenic
1068544706 10:58332892-58332914 CAAAATCCTATGGGGTGGGGAGG - Intergenic
1069373125 10:67767859-67767881 CAGAAAATGATGGGGTGAGAGGG - Intergenic
1069997534 10:72351945-72351967 GAGAATCAGATGGGATGCTGGGG - Intronic
1070159295 10:73856058-73856080 CAGAATCTGATGGGGTGCGGTGG - Intronic
1070300683 10:75201733-75201755 CACAATGGGATGGGGTGAGGAGG - Intergenic
1072576384 10:96704428-96704450 CAGAATCTGGCTGGGTGCGGTGG + Intronic
1073416333 10:103386041-103386063 AAGTATCTGATGGGGTTGGGAGG - Intronic
1074385946 10:113016833-113016855 CAGGATCTGGTGGGCAGCGGAGG - Intronic
1074904441 10:117848798-117848820 CAGGGTCTGATGTGGTGGGGGGG + Intergenic
1076154089 10:128189389-128189411 AAGAATCTGGTGAAGTGCGGTGG + Intergenic
1076421920 10:130337970-130337992 CAGAATCTGCTGCAGTGCCGAGG + Intergenic
1076496990 10:130903968-130903990 CAGGGTCTCTTGGGGTGCGGTGG - Intergenic
1077435834 11:2538799-2538821 CAGAACAAGATGGGGTGGGGTGG + Intronic
1078366618 11:10712026-10712048 CAGATTCTGATGGGGTAGGGGGG - Intergenic
1079380385 11:19932952-19932974 CAAAATGTGATGGGGTTGGGGGG + Intronic
1080484503 11:32691195-32691217 AAAAATTTGATGGGGTGTGGTGG - Intronic
1081008536 11:37778638-37778660 CAGAATTTTATGGGGTGGGAAGG - Intergenic
1087901962 11:103651173-103651195 GAGAATCTGAGGGTGTGTGGAGG + Intergenic
1088861181 11:113801129-113801151 CAAAATCTGACTGGGTGCAGTGG - Intronic
1089234753 11:117013890-117013912 CAGATTCTGAGGGGGGGGGGGGG + Intronic
1090468606 11:126958026-126958048 CAGATTCTGATGAGGTCAGGTGG + Intronic
1092609299 12:10154675-10154697 CTGAATCTGGCCGGGTGCGGTGG + Intergenic
1092990247 12:13890431-13890453 CAAAATCTGATCGTTTGCGGAGG + Intronic
1094187218 12:27657716-27657738 CAGTAGGTGATGGGGTGGGGCGG - Intronic
1094494187 12:30979262-30979284 CAGAAGCTGGTGGGAGGCGGTGG - Intronic
1096165984 12:49424758-49424780 TTGAATCTGGTGGGGGGCGGAGG - Intronic
1100211238 12:92400665-92400687 CAGAATCTGGTTGAGTGCAGTGG - Intergenic
1102674915 12:114650875-114650897 CAGAATCTGGTCGGTCGCGGTGG - Intergenic
1102757493 12:115354722-115354744 CAGAAGCTGAAGGGGTGAGCAGG - Intergenic
1103433995 12:120910289-120910311 CAGAATTTGATGGGGAGGGAGGG - Intergenic
1103637648 12:122320993-122321015 CAGAGTCTCACCGGGTGCGGTGG - Intronic
1103852760 12:123943915-123943937 CACAGTCTGTTGGGGTGAGGTGG - Intronic
1104140806 12:125984198-125984220 CAGTATCTGGTGGGGTGGCGGGG + Intergenic
1105473969 13:20715251-20715273 CAGAATCTCTGGGGGTGGGGGGG + Intronic
1107155498 13:37162459-37162481 GAGAATTTGATGGGGTGTAGAGG - Intergenic
1109619270 13:64880166-64880188 CATCAGCTGATGGGGTGAGGTGG - Intergenic
1109860371 13:68190460-68190482 AGGAATCTGGTGGGGGGCGGGGG - Intergenic
1110092467 13:71470612-71470634 CAGAATTAGACCGGGTGCGGTGG - Intronic
1111746712 13:92280743-92280765 GAAAATATGACGGGGTGCGGGGG + Intronic
1111929202 13:94496479-94496501 CAGAATCCGGCCGGGTGCGGTGG - Intergenic
1113667782 13:112153004-112153026 CAGAAACTGGCTGGGTGCGGTGG - Intergenic
1114611514 14:24044568-24044590 CAGAATCTGTCTGGGTGCAGTGG - Intergenic
1119062273 14:71487214-71487236 CAGAAGGTGATGGGGAGGGGAGG - Intronic
1120226326 14:81794845-81794867 CGGTATCTCATGGGGTGCAGTGG + Intergenic
1120456354 14:84735888-84735910 CAGAATGTGGTGGGGTGGGGGGG + Intergenic
1122865247 14:104600967-104600989 CAGAGTCTGATGGGGTCAGTGGG + Intronic
1123796734 15:23780198-23780220 TAAAATCTGATGGGGTAAGGAGG + Intergenic
1124117423 15:26858925-26858947 CAGAGTCTGGCTGGGTGCGGTGG - Intronic
1127384546 15:58456725-58456747 ATGAATGTGATGGGTTGCGGGGG - Intronic
1129248220 15:74292876-74292898 CAGTCTCTTATGGGGTGAGGTGG - Intronic
1130834284 15:87633952-87633974 CAGAGTCTGATGGGGACCTGAGG + Intergenic
1135285486 16:21189260-21189282 CAGATTCTGGCCGGGTGCGGTGG + Intergenic
1135483013 16:22838674-22838696 AAGAATGTGATGGGGCGAGGAGG + Intronic
1135856430 16:26015342-26015364 CAGAATCTGGTGGGGAATGGGGG + Intronic
1139717367 16:68824282-68824304 TAGAATCTGGCCGGGTGCGGTGG - Intronic
1139826295 16:69759941-69759963 TAAAATCTGACAGGGTGCGGTGG - Intergenic
1140175316 16:72653208-72653230 CTGAATCTGGCTGGGTGCGGTGG + Intergenic
1141787893 16:86213877-86213899 CAGATTCTTATGGAGTGCCGGGG + Intergenic
1144944905 17:18964853-18964875 CAGAACCTGACCGGGTGCAGTGG + Intronic
1146561037 17:33870975-33870997 CAGCATCTCAGGGGGTGGGGTGG - Intronic
1146946421 17:36876794-36876816 CAGAACCTGGCCGGGTGCGGTGG - Intergenic
1147164750 17:38587173-38587195 CAGAATTGGGTGGGGTGAGGAGG + Intronic
1147317057 17:39626107-39626129 CCGGATCTAATGGGGTGGGGAGG - Intergenic
1148661608 17:49338271-49338293 CAGAAACTGGTGGAGTGCAGTGG - Intronic
1149722970 17:58864351-58864373 CATAATCTGGTCCGGTGCGGTGG + Intronic
1150346361 17:64407430-64407452 CAGGAGCTGGCGGGGTGCGGTGG + Intronic
1151047117 17:70933600-70933622 CAGAAGCTGAGGGGGTGAGTGGG + Intergenic
1151574285 17:74943906-74943928 CAGCACCTGATGGGGTGGGATGG - Intronic
1152428036 17:80229265-80229287 GAGAGTCTGGTGGGGTGCAGAGG + Intronic
1153299939 18:3583658-3583680 CTGAATCTGACTGGGTGTGGTGG + Intronic
1154155429 18:11940749-11940771 CCTAATCTGATGGGGCGTGGTGG - Intergenic
1154335229 18:13459668-13459690 CCGAATTTGACCGGGTGCGGTGG - Intronic
1158339052 18:56445834-56445856 CAGATTCTGGTGCGGTACGGGGG - Intergenic
1160579763 18:79876849-79876871 CAGAATGTGCTGGGGTCAGGGGG + Intronic
1161192426 19:2965762-2965784 CAGAATCAGGCTGGGTGCGGTGG + Intergenic
1161524878 19:4748091-4748113 GAGAATTTGAAGGGGTGTGGAGG - Intergenic
1162101537 19:8342326-8342348 CAGACTCTGATTGGGGGCGGAGG + Intronic
1162913288 19:13861548-13861570 CAGACTCTGGTGGGGTGCGGAGG + Intergenic
1163401944 19:17099365-17099387 CAGAAGGTGATGGGGGGAGGAGG + Intronic
1164667659 19:30052212-30052234 CAGAGGGTAATGGGGTGCGGCGG + Intergenic
1166223059 19:41377721-41377743 CAGAATTTGGCTGGGTGCGGTGG + Intronic
1166477606 19:43142212-43142234 ATGAATCTCATGGGGTGAGGGGG + Intronic
1167555725 19:50194161-50194183 CAGAATCTGATCGGATGTGGCGG - Intronic
1168102831 19:54150057-54150079 CAGAAACTGAGGGCCTGCGGGGG - Intronic
925438347 2:3861505-3861527 CAGCATCCGATGAGGTGCTGTGG + Intergenic
928208361 2:29304208-29304230 CAGAATCTGGCTGGGCGCGGTGG + Intronic
930454225 2:51584399-51584421 CAAAATCTGACTGGGCGCGGTGG - Intergenic
931255263 2:60566404-60566426 CAGAATCTAATGGGTTGAGGAGG + Intergenic
931714707 2:65019894-65019916 CAGAATCAGAGGGGATGGGGTGG - Intronic
934044682 2:88163021-88163043 CAGAATCTGGCCAGGTGCGGTGG + Intergenic
935275886 2:101474762-101474784 CAGAACCTCTTGGGGTGGGGTGG - Intergenic
938936621 2:136132987-136133009 CAGAAGCTGATGGTGAGCAGGGG + Intergenic
941190301 2:162373384-162373406 CAGAATCACTTGGGGTGCTGTGG - Intronic
941657048 2:168155563-168155585 TAAAATCTGTTGGGGTGGGGGGG - Intronic
942134596 2:172912052-172912074 CAGAATCAGACTGGGTGTGGTGG - Intronic
944243249 2:197506210-197506232 TAGAATTTGGTTGGGTGCGGTGG + Intronic
945163860 2:206921419-206921441 TATAGTCTGATGGGGTGGGGTGG - Intergenic
945555262 2:211267902-211267924 CAGAGTCTGGTGTGGGGCGGGGG - Intergenic
946079821 2:217107943-217107965 CAGCATCTGATGGGTTGCAGAGG + Intergenic
946190856 2:218007219-218007241 CAGAATCTGAGGGGCTGAGAGGG - Intergenic
946312349 2:218889784-218889806 CAGAACCTGGTGGGGTGGGAGGG - Intronic
947010075 2:225555910-225555932 CAGGATCTGTAGGGGTGCAGGGG - Intronic
949066492 2:241993826-241993848 CAGAAGGAGATGGGGTGGGGAGG + Intergenic
1168826639 20:818762-818784 CAGAAACTGGTGGGGCACGGTGG - Intergenic
1170156584 20:13274542-13274564 CAGAGCCTGAAGGGGTGGGGAGG - Intronic
1170561654 20:17563635-17563657 CAGAAACTGGTGGGGTGGTGGGG - Intronic
1171284761 20:23928099-23928121 CACAATCTGATTTGCTGCGGTGG - Intergenic
1172679788 20:36704360-36704382 TAGAATATAGTGGGGTGCGGTGG - Intronic
1173472102 20:43332165-43332187 AAGGATCTGGTGGGGTGGGGCGG + Intergenic
1173561504 20:44009070-44009092 CAGAATCTCATGGTTTGGGGTGG + Intronic
1174179139 20:48664085-48664107 GAGAATCTGGTCGGGCGCGGTGG + Intronic
1174626669 20:51920642-51920664 CAGAATCTCACTGGGTACGGTGG - Intergenic
1175780129 20:61676900-61676922 GAGGACCTGATGGGGTGAGGTGG + Intronic
1176015376 20:62928415-62928437 CAGCTTCTGCTGGGGGGCGGGGG - Intronic
1178529683 21:33365363-33365385 AAAAATCTGGTTGGGTGCGGTGG + Intergenic
1179565577 21:42245833-42245855 CAGACTCTGATGAGGAGGGGAGG + Intronic
1180224296 21:46380582-46380604 CAGTAGCTGCTGGGGTGGGGTGG - Intronic
1180981346 22:19879535-19879557 CAGGATGTGGTGGGGGGCGGGGG + Intronic
1181654061 22:24280728-24280750 CAAAAACTAATGGGGGGCGGTGG - Intronic
1183490666 22:38113923-38113945 CAGCATCAGATGGGGTGGGCGGG - Intronic
1183827116 22:40397277-40397299 CAGAATCTGGCTGGGTGTGGTGG + Intronic
1184367517 22:44061902-44061924 AAGAATCTGACTGGGTGTGGTGG - Intronic
1184714829 22:46275106-46275128 CAGTTTCTGACTGGGTGCGGTGG - Intronic
1184755782 22:46515042-46515064 CTGAAGCTGAGGGGGTGCTGGGG - Intronic
950545332 3:13634780-13634802 CAGAGTCTGAGGCGGTCCGGGGG + Intronic
950976839 3:17255485-17255507 CAGGATCTGGCCGGGTGCGGTGG - Intronic
953321776 3:41979041-41979063 CAGAATGTGGCTGGGTGCGGTGG - Intergenic
955068337 3:55551592-55551614 CAAAATCTGATGGGGTAGGCTGG + Intronic
955332167 3:58056386-58056408 CAGCATCTGGCCGGGTGCGGTGG - Intronic
956018768 3:64911893-64911915 CAAAATCTGGTCGGGCGCGGTGG + Intergenic
956745912 3:72310965-72310987 CAGAAGCTCATGGCGTGCAGAGG - Intergenic
958756261 3:98252881-98252903 CAGAGCCTGTTGGGGTGTGGGGG + Intergenic
960702772 3:120452947-120452969 CAGATTCTGAGAGGGTGCAGTGG - Intergenic
961665384 3:128490770-128490792 CAGAATCTGCTGGGGTCTTGAGG + Intronic
964238866 3:154567611-154567633 CAAAAGCTGATGGAGTGAGGAGG - Intergenic
964537077 3:157734885-157734907 CAGAATGAGGTGGGGTGTGGGGG - Intergenic
966118205 3:176490307-176490329 CAGAATCTGGTCAGGTGTGGTGG - Intergenic
967845367 3:194038568-194038590 CAGCAGCTGGCGGGGTGCGGTGG - Intergenic
968661008 4:1798688-1798710 CAGGCTCATATGGGGTGCGGGGG + Intronic
970568243 4:17353382-17353404 CAGAATCGGGCCGGGTGCGGTGG + Intergenic
970635981 4:18009852-18009874 CAGAACCTTATAGGGTGAGGAGG - Intronic
971853575 4:32014701-32014723 CAGGGTCTGTTGGGGTGTGGGGG + Intergenic
974233306 4:59146228-59146250 CAGATTCTGGTGAGGTGTGGAGG - Intergenic
975553250 4:75634463-75634485 CAGGATCTCATGGGGCCCGGGGG - Intergenic
975826173 4:78321554-78321576 TAGAATCTGACTGGGTTCGGTGG + Intronic
976598346 4:86915091-86915113 CAGAATACAATGGGGTGAGGAGG - Intronic
980091490 4:128447602-128447624 CAGAAGCTGAGGGGGTGGTGTGG + Intergenic
991663057 5:68969621-68969643 CTGAATGTGATGGAGTGTGGCGG - Intergenic
992377544 5:76203279-76203301 CAGAGTTTGATTGGGTGAGGGGG + Intronic
994353151 5:98769327-98769349 AGGAAGCTGCTGGGGTGCGGGGG + Exonic
994627658 5:102242019-102242041 GAGAATCTCTTGGGGTGGGGAGG + Intronic
995515548 5:112951308-112951330 CATAATTTGACTGGGTGCGGTGG - Intergenic
995614590 5:113946759-113946781 CAAAATCTGGCCGGGTGCGGTGG - Intergenic
996370808 5:122750489-122750511 CAGACTCTGGCTGGGTGCGGTGG - Intergenic
997382639 5:133448716-133448738 CAGAATCCCCAGGGGTGCGGGGG + Intronic
997393811 5:133540156-133540178 CAGAATCTGATGGGGTAAGCTGG - Intronic
997611690 5:135220120-135220142 AAGATTCTGATGTGGTGCTGAGG + Intronic
998321027 5:141231225-141231247 CAGATTTTGACTGGGTGCGGTGG - Intergenic
999180202 5:149664862-149664884 CAGAATGGGCTGGGGTGCAGCGG + Intergenic
1002659908 5:180784564-180784586 CAAAATCTGGCCGGGTGCGGTGG - Intergenic
1003696799 6:8415073-8415095 CAGAATCTGTTGAGGTGCCAAGG + Intronic
1007469329 6:42078175-42078197 AAGTCTCTGGTGGGGTGCGGTGG - Exonic
1007814048 6:44507717-44507739 CAGAATCAGTTGGTGTGGGGTGG + Intergenic
1007829825 6:44629673-44629695 CAGGGTCTGCTGGGGTGCTGGGG + Intergenic
1016043155 6:139453262-139453284 CAGCATCTGATAGTGTGCTGAGG + Intergenic
1016558488 6:145367731-145367753 CAGACTCTCAGGGGGTGAGGAGG + Intergenic
1016739476 6:147512241-147512263 CACATTCTGGCGGGGTGCGGTGG - Intronic
1018311795 6:162517201-162517223 CAGAATCTCTCGGGGTGGGGTGG + Intronic
1018804275 6:167246875-167246897 CAGAATCTGAGGTTGTGGGGAGG - Intergenic
1019142436 6:169957078-169957100 CTGCATCTGAGGGGGTGTGGTGG + Intergenic
1019142450 6:169957112-169957134 CTGCATCTGAGGGGGTGTGGTGG + Intergenic
1019142464 6:169957146-169957168 CTGCATCTGAGGGGGTGTGGTGG + Intergenic
1019142489 6:169957215-169957237 CTGCATCTGAGGGGGTGTGGTGG + Intergenic
1019142513 6:169957284-169957306 CTGCATCTGAGGGGGTGTGGTGG + Intergenic
1020413049 7:7914618-7914640 CGTAATCTGATGGGGTGATGGGG + Intronic
1021566647 7:22023149-22023171 CAGAATCTGGCCGGGTGCGGTGG - Intergenic
1021594504 7:22300853-22300875 AAGAGTGTGATGGGGTGGGGTGG - Intronic
1022040648 7:26578414-26578436 CAAAATCTGCTGGTGTGTGGGGG + Intergenic
1023641521 7:42263733-42263755 CAAGATCTGGTGGGGTGCGGTGG - Intergenic
1023783830 7:43685483-43685505 CAGAATCTTTTGGTTTGCGGTGG + Intronic
1024215326 7:47243541-47243563 CAAAAACTGATTGGGTGTGGTGG + Intergenic
1026467635 7:70668264-70668286 CAGAATCTGGCTGGGCGCGGTGG - Intronic
1028299916 7:89185571-89185593 CAGGATCTGGTCGGGCGCGGTGG + Intronic
1032588723 7:133172646-133172668 TAAAATATGATGGGGAGCGGTGG + Intergenic
1034605587 7:152310286-152310308 CAGAATCTGTCTGGGTGCAGTGG + Intronic
1036502062 8:9323231-9323253 CAGAAGCTGATGGGGCCTGGAGG - Intergenic
1037127138 8:15365339-15365361 GAAAGTCTGAAGGGGTGCGGAGG + Intergenic
1037275620 8:17175012-17175034 CACAATGTGACTGGGTGCGGTGG - Intronic
1039070299 8:33643549-33643571 CAGAATCTGATCGGGCATGGTGG + Intergenic
1040492410 8:47936964-47936986 CAGTATCTGGCCGGGTGCGGCGG + Intronic
1041061721 8:54041214-54041236 CAAATTCTGGTCGGGTGCGGTGG + Intergenic
1043457896 8:80430429-80430451 CAGAACCGGAAGGGGTGGGGGGG - Intergenic
1043846319 8:85167993-85168015 TAGATTCTGGTCGGGTGCGGTGG - Intergenic
1045388623 8:101693521-101693543 CAGAATCTGATTGGGTAGTGTGG + Intronic
1049381865 8:142320148-142320170 CAGAATGTGAGGGGATGCAGTGG - Intronic
1051177945 9:14379968-14379990 AAAAATCTGACTGGGTGCGGTGG - Intronic
1056746377 9:89307244-89307266 CAAAATGTGGTCGGGTGCGGGGG + Intergenic
1058404827 9:104660897-104660919 AAGCATCTGATCGGGTGTGGTGG - Intergenic
1058965249 9:110031415-110031437 CACACTCTGGTGGGGTGCAGTGG - Intronic
1059395592 9:114032263-114032285 CAGAATCTGACAGGGAGTGGTGG + Intronic
1060372666 9:123089089-123089111 AATAATCTGATGGGGTGAGAGGG + Intronic
1060740273 9:126093284-126093306 TATCATCTGGTGGGGTGCGGTGG - Intergenic
1060954181 9:127626273-127626295 CTGATTTTGGTGGGGTGCGGTGG - Intronic
1060958794 9:127664375-127664397 CAGAATCTGAGAGCGTGCAGAGG + Intronic
1185804257 X:3042783-3042805 TAGAATCTGGCCGGGTGCGGTGG - Intronic
1186201366 X:7158347-7158369 CAAAATCTGCTGGGATGAGGAGG + Intergenic
1187797946 X:23024818-23024840 CAGAATCTGATGAGGTAAGCAGG - Intergenic
1187887481 X:23903080-23903102 GAGAATCTGGCCGGGTGCGGCGG + Intronic
1189733902 X:44049641-44049663 AAGCAACTGATGGGGTGTGGGGG + Intergenic
1190512263 X:51185380-51185402 CAGATTCTGAAGGGGTCCTGTGG + Intergenic
1191853024 X:65600020-65600042 AAGAATCTGATGTGGTGTGGTGG + Intronic
1193700212 X:84750921-84750943 TAGAATCTGGTAGAGTGCGGTGG + Intergenic
1193732633 X:85119422-85119444 CAGCATCTGATGGAGAGCAGTGG - Intergenic
1196911525 X:120488840-120488862 CAGAATCAGGCCGGGTGCGGTGG - Intergenic
1198148298 X:133881364-133881386 CACAATTTGAAGGGGTGTGGGGG + Intronic
1198235820 X:134734926-134734948 CAGACTCAGATGGGGGGTGGTGG + Intronic
1199327474 X:146515859-146515881 GAGAACCTGGCGGGGTGCGGTGG - Intergenic
1201576386 Y:15465844-15465866 CAAAATCTGCTGGGATGAGGAGG + Intergenic