ID: 1070160170

View in Genome Browser
Species Human (GRCh38)
Location 10:73861962-73861984
Sequence ACACAAATCCTGCTTCTCCC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070160166_1070160170 3 Left 1070160166 10:73861936-73861958 CCCATTTTATAGAAAGAGAAACC No data
Right 1070160170 10:73861962-73861984 ACACAAATCCTGCTTCTCCCCGG No data
1070160167_1070160170 2 Left 1070160167 10:73861937-73861959 CCATTTTATAGAAAGAGAAACCA 0: 1
1: 2
2: 22
3: 239
4: 1441
Right 1070160170 10:73861962-73861984 ACACAAATCCTGCTTCTCCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070160170 Original CRISPR ACACAAATCCTGCTTCTCCC CGG Intronic
No off target data available for this crispr