ID: 1070160350

View in Genome Browser
Species Human (GRCh38)
Location 10:73863134-73863156
Sequence TCTACTTTGTGGAAGGAGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070160345_1070160350 -9 Left 1070160345 10:73863120-73863142 CCTCTAGCAACAGCTCTACTTTG 0: 1
1: 0
2: 0
3: 8
4: 126
Right 1070160350 10:73863134-73863156 TCTACTTTGTGGAAGGAGGTGGG No data
1070160344_1070160350 -8 Left 1070160344 10:73863119-73863141 CCCTCTAGCAACAGCTCTACTTT 0: 1
1: 0
2: 2
3: 11
4: 163
Right 1070160350 10:73863134-73863156 TCTACTTTGTGGAAGGAGGTGGG No data
1070160340_1070160350 18 Left 1070160340 10:73863093-73863115 CCAAACCCAGCTTTGTCCTAAAC 0: 1
1: 0
2: 1
3: 8
4: 170
Right 1070160350 10:73863134-73863156 TCTACTTTGTGGAAGGAGGTGGG No data
1070160341_1070160350 13 Left 1070160341 10:73863098-73863120 CCCAGCTTTGTCCTAAACTTTCC 0: 1
1: 0
2: 0
3: 20
4: 210
Right 1070160350 10:73863134-73863156 TCTACTTTGTGGAAGGAGGTGGG No data
1070160342_1070160350 12 Left 1070160342 10:73863099-73863121 CCAGCTTTGTCCTAAACTTTCCC 0: 1
1: 0
2: 0
3: 18
4: 195
Right 1070160350 10:73863134-73863156 TCTACTTTGTGGAAGGAGGTGGG No data
1070160343_1070160350 2 Left 1070160343 10:73863109-73863131 CCTAAACTTTCCCTCTAGCAACA 0: 1
1: 0
2: 2
3: 14
4: 219
Right 1070160350 10:73863134-73863156 TCTACTTTGTGGAAGGAGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070160350 Original CRISPR TCTACTTTGTGGAAGGAGGT GGG Intronic
No off target data available for this crispr