ID: 1070160659

View in Genome Browser
Species Human (GRCh38)
Location 10:73865053-73865075
Sequence GACCCTGTCAAGCTTCTCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070160659_1070160668 28 Left 1070160659 10:73865053-73865075 CCAGTGAGAAGCTTGACAGGGTC No data
Right 1070160668 10:73865104-73865126 TCACCAGAGACACTGTGAATGGG No data
1070160659_1070160664 -4 Left 1070160659 10:73865053-73865075 CCAGTGAGAAGCTTGACAGGGTC No data
Right 1070160664 10:73865072-73865094 GGTCTCCTGGGCTGGGCTTGTGG No data
1070160659_1070160667 27 Left 1070160659 10:73865053-73865075 CCAGTGAGAAGCTTGACAGGGTC No data
Right 1070160667 10:73865103-73865125 ATCACCAGAGACACTGTGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070160659 Original CRISPR GACCCTGTCAAGCTTCTCAC TGG (reversed) Intronic
No off target data available for this crispr