ID: 1070161307

View in Genome Browser
Species Human (GRCh38)
Location 10:73868258-73868280
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070161298_1070161307 26 Left 1070161298 10:73868209-73868231 CCTCTAGGGTTTCAGCACAGCTT 0: 1
1: 0
2: 0
3: 12
4: 112
Right 1070161307 10:73868258-73868280 CAGAGGAAGCAGCAGGAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr