ID: 1070162585

View in Genome Browser
Species Human (GRCh38)
Location 10:73874717-73874739
Sequence CGCCCCGGAGCCGCCCTCGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 285
Summary {0: 1, 1: 0, 2: 3, 3: 19, 4: 262}

Found 16 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070162576_1070162585 -8 Left 1070162576 10:73874702-73874724 CCGCCGGCCCCGCCCCGCCCCGG 0: 1
1: 14
2: 111
3: 584
4: 2533
Right 1070162585 10:73874717-73874739 CGCCCCGGAGCCGCCCTCGCTGG 0: 1
1: 0
2: 3
3: 19
4: 262
1070162565_1070162585 21 Left 1070162565 10:73874673-73874695 CCGGCCCGCCCCCGGGGAGGGGC 0: 1
1: 0
2: 3
3: 62
4: 499
Right 1070162585 10:73874717-73874739 CGCCCCGGAGCCGCCCTCGCTGG 0: 1
1: 0
2: 3
3: 19
4: 262
1070162561_1070162585 23 Left 1070162561 10:73874671-73874693 CCCCGGCCCGCCCCCGGGGAGGG 0: 1
1: 0
2: 6
3: 52
4: 420
Right 1070162585 10:73874717-73874739 CGCCCCGGAGCCGCCCTCGCTGG 0: 1
1: 0
2: 3
3: 19
4: 262
1070162566_1070162585 17 Left 1070162566 10:73874677-73874699 CCCGCCCCCGGGGAGGGGCCTCC 0: 1
1: 1
2: 10
3: 44
4: 436
Right 1070162585 10:73874717-73874739 CGCCCCGGAGCCGCCCTCGCTGG 0: 1
1: 0
2: 3
3: 19
4: 262
1070162575_1070162585 -5 Left 1070162575 10:73874699-73874721 CCGCCGCCGGCCCCGCCCCGCCC 0: 3
1: 31
2: 153
3: 1033
4: 4297
Right 1070162585 10:73874717-73874739 CGCCCCGGAGCCGCCCTCGCTGG 0: 1
1: 0
2: 3
3: 19
4: 262
1070162570_1070162585 11 Left 1070162570 10:73874683-73874705 CCCGGGGAGGGGCCTCCCGCCGC 0: 1
1: 0
2: 2
3: 41
4: 275
Right 1070162585 10:73874717-73874739 CGCCCCGGAGCCGCCCTCGCTGG 0: 1
1: 0
2: 3
3: 19
4: 262
1070162554_1070162585 29 Left 1070162554 10:73874665-73874687 CCCGGCCCCCGGCCCGCCCCCGG 0: 2
1: 1
2: 41
3: 364
4: 1941
Right 1070162585 10:73874717-73874739 CGCCCCGGAGCCGCCCTCGCTGG 0: 1
1: 0
2: 3
3: 19
4: 262
1070162559_1070162585 24 Left 1070162559 10:73874670-73874692 CCCCCGGCCCGCCCCCGGGGAGG 0: 1
1: 0
2: 2
3: 42
4: 402
Right 1070162585 10:73874717-73874739 CGCCCCGGAGCCGCCCTCGCTGG 0: 1
1: 0
2: 3
3: 19
4: 262
1070162573_1070162585 -1 Left 1070162573 10:73874695-73874717 CCTCCCGCCGCCGGCCCCGCCCC 0: 2
1: 7
2: 103
3: 592
4: 3472
Right 1070162585 10:73874717-73874739 CGCCCCGGAGCCGCCCTCGCTGG 0: 1
1: 0
2: 3
3: 19
4: 262
1070162568_1070162585 13 Left 1070162568 10:73874681-73874703 CCCCCGGGGAGGGGCCTCCCGCC 0: 1
1: 0
2: 2
3: 31
4: 228
Right 1070162585 10:73874717-73874739 CGCCCCGGAGCCGCCCTCGCTGG 0: 1
1: 0
2: 3
3: 19
4: 262
1070162567_1070162585 16 Left 1070162567 10:73874678-73874700 CCGCCCCCGGGGAGGGGCCTCCC 0: 1
1: 0
2: 6
3: 39
4: 370
Right 1070162585 10:73874717-73874739 CGCCCCGGAGCCGCCCTCGCTGG 0: 1
1: 0
2: 3
3: 19
4: 262
1070162569_1070162585 12 Left 1070162569 10:73874682-73874704 CCCCGGGGAGGGGCCTCCCGCCG 0: 1
1: 0
2: 2
3: 13
4: 178
Right 1070162585 10:73874717-73874739 CGCCCCGGAGCCGCCCTCGCTGG 0: 1
1: 0
2: 3
3: 19
4: 262
1070162563_1070162585 22 Left 1070162563 10:73874672-73874694 CCCGGCCCGCCCCCGGGGAGGGG 0: 1
1: 0
2: 3
3: 64
4: 499
Right 1070162585 10:73874717-73874739 CGCCCCGGAGCCGCCCTCGCTGG 0: 1
1: 0
2: 3
3: 19
4: 262
1070162574_1070162585 -4 Left 1070162574 10:73874698-73874720 CCCGCCGCCGGCCCCGCCCCGCC 0: 3
1: 10
2: 96
3: 545
4: 2688
Right 1070162585 10:73874717-73874739 CGCCCCGGAGCCGCCCTCGCTGG 0: 1
1: 0
2: 3
3: 19
4: 262
1070162556_1070162585 28 Left 1070162556 10:73874666-73874688 CCGGCCCCCGGCCCGCCCCCGGG 0: 2
1: 7
2: 38
3: 290
4: 1993
Right 1070162585 10:73874717-73874739 CGCCCCGGAGCCGCCCTCGCTGG 0: 1
1: 0
2: 3
3: 19
4: 262
1070162571_1070162585 10 Left 1070162571 10:73874684-73874706 CCGGGGAGGGGCCTCCCGCCGCC 0: 1
1: 0
2: 4
3: 34
4: 313
Right 1070162585 10:73874717-73874739 CGCCCCGGAGCCGCCCTCGCTGG 0: 1
1: 0
2: 3
3: 19
4: 262

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070162585 Original CRISPR CGCCCCGGAGCCGCCCTCGC TGG Intergenic
900240800 1:1616323-1616345 CGCGCAGGAGCCGCCAGCGCCGG - Intronic
901055544 1:6447313-6447335 CGCCGCGGCGCCCCCCGCGCGGG + Intronic
901058445 1:6460527-6460549 CACCCCGGAACCGGCGTCGCTGG + Exonic
902478841 1:16701324-16701346 CGCCGCGGCGCCTCCCGCGCGGG - Intergenic
903458400 1:23504274-23504296 CGCCCGGGAGCCGCCCCGTCCGG + Intergenic
905308470 1:37034329-37034351 AGCCCAGGAGCCTCGCTCGCGGG - Intergenic
905617103 1:39408919-39408941 CTCCCCGGCCCCGCCCCCGCCGG + Intronic
906107792 1:43305103-43305125 CGCCCCAGCACCGCCCACGCAGG - Exonic
910200014 1:84690122-84690144 GGCCCCGGGACCGCTCTCGCTGG - Intronic
910406927 1:86899706-86899728 CGCCCAGCAGCCGCCCTGTCCGG - Intronic
912539982 1:110407481-110407503 CGTCCCCGAGACGCCCTGGCCGG + Intronic
913022815 1:114804609-114804631 CGCCCGGCAGCCGCCCTGTCTGG - Intergenic
913323352 1:117605973-117605995 CGCCCCTGAGCCGCCCTCCCGGG - Exonic
914787973 1:150851082-150851104 CGCCCCGCAGCCGCCCCGTCCGG + Intronic
915302861 1:154961549-154961571 CGCCTCGGCGCCGCCCCCACCGG - Exonic
915552256 1:156642049-156642071 CGCCCCTGCCCCGCCCTCCCCGG - Exonic
915606199 1:156952907-156952929 CAGCCCTGAGCCGCCCTGGCTGG + Intronic
916890135 1:169106195-169106217 GGCCCCGAACCCGCCCTCTCGGG + Intronic
917304624 1:173613428-173613450 CGCCCGGCAGCCGCCCCCTCTGG + Intronic
917553311 1:176058052-176058074 CGCCCGGCAGCCGCCCCGGCCGG + Intronic
918022740 1:180710929-180710951 CGCCCAGCAGCCGCCCTGTCTGG - Intronic
919782043 1:201227267-201227289 CCCCCCGGAGCCTCCCTGACAGG - Intronic
922119037 1:222644235-222644257 CGCTCTGGCCCCGCCCTCGCCGG + Intronic
922473183 1:225888996-225889018 AGCCCCGGGGCCGCCCTGACCGG - Exonic
922925275 1:229342622-229342644 CGCCCCCTCCCCGCCCTCGCCGG - Intronic
924824150 1:247522177-247522199 CGCCCGGCAGCCGCCCTGTCTGG + Intronic
1062774791 10:135762-135784 GGCCCCGCCGCCGCCCTCGCAGG - Intronic
1064086393 10:12349314-12349336 GGGCCCGTACCCGCCCTCGCCGG + Intergenic
1064418143 10:15168371-15168393 CGCCACGGAGAAGCCATCGCGGG + Intronic
1066325356 10:34353062-34353084 CGCCCCGCAGCTGCCCTGTCTGG + Intronic
1067477979 10:46578866-46578888 CGCCCGGGACCCGCCCTGGCTGG + Intronic
1067616760 10:47762921-47762943 CGCCCGGGACCCGCCCTGGCTGG - Intergenic
1067726785 10:48776595-48776617 GGCCAGGGAGCCACCCTCGCTGG + Intronic
1067796711 10:49326499-49326521 CTCCCCAGAGCCGCCCCCACCGG + Exonic
1069651612 10:70053454-70053476 GGCCCCCGAGCGGCCCTCCCCGG - Intronic
1070162585 10:73874717-73874739 CGCCCCGGAGCCGCCCTCGCTGG + Intergenic
1070367325 10:75750228-75750250 CGCCCGGCAGCCGCCCTGTCCGG - Intronic
1072654397 10:97319957-97319979 CGCCCCGGAGCCATCCTCGCCGG - Exonic
1072656512 10:97334119-97334141 CGTCCCTGAGCCATCCTCGCCGG + Exonic
1073414267 10:103368212-103368234 GGCACCGGGGCCGCCCCCGCCGG - Exonic
1073432140 10:103493806-103493828 CGCCGCGGTCCCGCCCGCGCCGG - Intergenic
1074814582 10:117134653-117134675 AGCCCCGGAGCCGCGCGCCCCGG - Intronic
1075050983 10:119182358-119182380 CGCCCGGCAGCCGCCCTGTCCGG - Intergenic
1075885503 10:125896239-125896261 CGGCCCTGGGCCGCCCTCCCGGG - Intronic
1076806110 10:132859660-132859682 CGCCCCGGAGCAGCCACAGCAGG + Intronic
1076890702 10:133281832-133281854 CACCCCGGAGCCGGCGCCGCAGG + Intronic
1079173943 11:18121296-18121318 CGCCCGGCAGCCGCCCTGTCCGG + Intronic
1083329698 11:61891700-61891722 CGCCTCGACGCCGCCCTCCCTGG - Intronic
1083610173 11:64000635-64000657 CCTCCCGGAGCCGCCCTGCCTGG - Intronic
1083809614 11:65096314-65096336 CGCTCCGGAGCCTCCCCCTCGGG - Exonic
1084087171 11:66860002-66860024 CGCCGCGGAGCCCCCCGCCCCGG + Exonic
1085038450 11:73313262-73313284 GGCACCGGAGCTGCCCTCACTGG - Intronic
1086434832 11:86770740-86770762 CGCCCCGCAGCCGCCCCGTCTGG - Intergenic
1087014666 11:93543375-93543397 CGCGCCAGAGTCGCCCGCGCGGG - Exonic
1089346991 11:117797005-117797027 CGCCGCCCAGCCGCCCGCGCAGG + Intronic
1090260361 11:125314804-125314826 AGCCCCGGGGCAGCCCTGGCTGG + Intronic
1091218709 11:133918590-133918612 GGCCCCGGAGCAGCCCGCGGTGG + Intronic
1095452766 12:42350045-42350067 CGCCCGGCAGCCGCCCTGTCTGG - Intronic
1096024701 12:48350805-48350827 CGGCCCGGTGCCTCCCTCCCGGG + Intronic
1098333103 12:69375061-69375083 CGCCCGGCAGCCGCCCCCTCCGG - Intronic
1098550373 12:71755140-71755162 CGCCCCGCCGCCGCCGCCGCCGG - Exonic
1099971363 12:89503916-89503938 CGCCCCGCAGCCACCCTGTCTGG + Intronic
1102254060 12:111406028-111406050 CGCCCCCGGGCCGCCGCCGCCGG - Exonic
1102962043 12:117099287-117099309 CGCCCCGGGGCCCCCGCCGCGGG - Exonic
1103045421 12:117731345-117731367 CGCCCAGCAGCCGCCCTGTCTGG + Intronic
1103085790 12:118061117-118061139 CGCCCCCGCGCCGCCCGCCCCGG + Intronic
1103595536 12:122022494-122022516 CGGCCCCGAGCCCCCCTCCCGGG - Intronic
1110436309 13:75481540-75481562 CGCCCCGCAGCCGCCCGCCTCGG + Exonic
1110705977 13:78602267-78602289 CGCGCCCGCGCCGCCCGCGCCGG + Exonic
1111672637 13:91348609-91348631 CGCCCCGAGGCTGCCCACGCGGG - Intergenic
1112091717 13:96090550-96090572 CGCCCCGGCGCGGCTCTCTCAGG - Intergenic
1112503550 13:99959755-99959777 CGCCCTAGAGCGCCCCTCGCCGG + Intergenic
1113378670 13:109784941-109784963 CGCGCCGCCGTCGCCCTCGCTGG + Exonic
1113378867 13:109785874-109785896 CGCCTCGTCGCCGCCCGCGCCGG + Exonic
1113907451 13:113826451-113826473 CCTCCCGGCGCCGGCCTCGCAGG + Intronic
1113907464 13:113826490-113826512 CCTCCCGGCGCCGGCCTCGCAGG + Intronic
1113907477 13:113826529-113826551 CCTCCCGGCGCCGGCCTCGCAGG + Intronic
1113907502 13:113826607-113826629 CCTCCCGGCGCCGGCCTCGCAGG + Intronic
1114578702 14:23736853-23736875 CGCCCGGCAGCCGCCCTGTCTGG + Intergenic
1115761104 14:36580159-36580181 CGCCCCGCACCTGGCCTCGCCGG + Intergenic
1117596977 14:57334044-57334066 CGCCCAGGAGCCGCCCCGTCCGG + Intergenic
1119326085 14:73760249-73760271 CGCCGCGGTGCCGCGCGCGCCGG - Exonic
1122081579 14:99270905-99270927 CGGCCCGGAGCCGGCTCCGCAGG + Intronic
1202872556 14_GL000225v1_random:177678-177700 CGGCCCTGGGCCGCCCTCCCGGG + Intergenic
1123709982 15:22980194-22980216 GGCCCCGCCGCCGCCCTGGCCGG + Intronic
1128153540 15:65377852-65377874 GGCCCCGGCGCCGGCCCCGCGGG - Exonic
1129150312 15:73684294-73684316 CGCACCGGAGCCGCCTTTCCGGG + Exonic
1130295924 15:82647220-82647242 CGCCCCCGAGACTCCCTCTCCGG + Intronic
1131174672 15:90202075-90202097 CTACCCCGAGCCGCCCTCGGGGG - Intronic
1131510116 15:93045068-93045090 AGCCCCGCAGCCGCCCTGCCTGG + Exonic
1132689813 16:1177428-1177450 CGCCCCGGAGTCCCCCAAGCTGG + Intronic
1132974276 16:2703682-2703704 TGGCCCAGAGCCTCCCTCGCTGG + Intronic
1133218445 16:4307606-4307628 CGCCCCGGACGTGACCTCGCGGG - Intergenic
1133365657 16:5207151-5207173 CGCTCCGGAGCCTCCCCCTCGGG - Intergenic
1134134195 16:11668681-11668703 CTCCCCCGAGCCGCGCCCGCCGG - Intronic
1137614561 16:49838910-49838932 GGTCCCGGGGCCGCCCCCGCGGG + Intronic
1139639216 16:68278911-68278933 CGCCCGGCAGCCGCCCTGTCCGG - Intronic
1141638623 16:85328816-85328838 CGCCCCGGGGCCTCCCGCGGTGG + Intergenic
1141687413 16:85578200-85578222 TGTCCCGGTGCCGCCCTCCCAGG - Intergenic
1142011781 16:87718982-87719004 CGCCCGGCAGCCGCCCCCTCCGG + Intronic
1142196821 16:88742846-88742868 CGCCCCTGAGCAGCCGTGGCTGG + Intronic
1142204149 16:88774784-88774806 CACCCCGGAGCCGGCTGCGCAGG + Intronic
1142490170 17:273478-273500 CTCCCCGACGTCGCCCTCGCTGG - Intronic
1142705266 17:1689894-1689916 CGCCCGGCAGCCGCCCCCTCTGG - Intergenic
1142741839 17:1936158-1936180 AGCCCCGGTGCCGCCGTCGGGGG + Exonic
1142760917 17:2041594-2041616 CGCCCCGGGCCGGCCCGCGCGGG + Exonic
1142764103 17:2056169-2056191 CGCCCTGGCGCCGCCCTGGCCGG - Intronic
1144496472 17:15749327-15749349 CGCCCAGGACGCGCCCGCGCTGG - Intergenic
1144606056 17:16666731-16666753 CGCCCAGGACGCGCCCGCGCTGG - Intergenic
1144956585 17:19021747-19021769 AGCCCCGGAGCTACCCTTGCTGG + Exonic
1145251399 17:21298749-21298771 TGCCCCGGAGGCGCCTTCTCCGG - Intronic
1146183080 17:30709481-30709503 CGCCCCACAGCCTCCCTCCCCGG + Intergenic
1147150355 17:38510513-38510535 CGCCCCGGAGCCGCCCGGCTCGG + Exonic
1147375894 17:40022368-40022390 GGCCCCCCAGCTGCCCTCGCCGG - Intronic
1147723717 17:42553952-42553974 CGCCCCAGAGCGGCTCCCGCAGG - Intronic
1147970927 17:44218947-44218969 CGCCCCCGAGCCACCCACCCCGG + Intronic
1151320395 17:73349161-73349183 GGCCCCGGAGCCAGCCTGGCGGG + Intronic
1151558730 17:74859994-74860016 GGCCCCGGAGCCGCGGACGCCGG - Intronic
1152552190 17:81035382-81035404 GGCCCCGGGGCCGCCCTGGTCGG - Intronic
1152593992 17:81229388-81229410 GGCCCCACAGCCGCCCTCCCAGG - Exonic
1152672689 17:81618414-81618436 CGCCCCGCAGCCGCCCCGTCTGG + Intronic
1153935236 18:9914626-9914648 CGCCCAGGAGGCGCCCCCGCGGG - Intronic
1155057908 18:22201036-22201058 CGCCCCGGAGGCGGGCTGGCTGG - Exonic
1155507337 18:26547006-26547028 CCGCCCCCAGCCGCCCTCGCTGG - Intronic
1159040674 18:63320370-63320392 CGGCCCGGACGCGCCCTCCCCGG - Intergenic
1160406835 18:78652213-78652235 AGCCCCGGAGCTGCCCTCCTGGG - Intergenic
1161087876 19:2343480-2343502 CGCCCCGCAGCCACCCACCCAGG - Intronic
1162032938 19:7925174-7925196 CGCCCCGGAGCCCCCAGCCCGGG - Exonic
1162328086 19:10010416-10010438 CGCCCCGCAGCCGCCCCGACTGG - Exonic
1162790759 19:13061497-13061519 CGCCCCGCCGCAGCCCTCGGAGG + Intronic
1163612954 19:18310454-18310476 CGCCCTTGAGCCACCCTGGCAGG - Intronic
1164168529 19:22703052-22703074 CGCCCAGCAGCCGCCCTGTCTGG - Intergenic
1164168540 19:22703092-22703114 CGCCCAGCAGCCGCCCTGTCTGG - Intergenic
1165579540 19:36850331-36850353 AGCCCGGGAGCCGCCCTCTGAGG + Intronic
1166074154 19:40404139-40404161 CCCCTCGGCGCTGCCCTCGCAGG + Intronic
1166106817 19:40601657-40601679 CCCCCCGGAGCCGCTCTCTCGGG - Intronic
1166191622 19:41180349-41180371 CGCCCGGCAGCCGCCCCGGCCGG + Intergenic
1166611707 19:44204126-44204148 CGCCCGGCAGCCGCCCTGTCTGG + Intergenic
1167019010 19:46860859-46860881 CGCGCGGGAGCGGCCGTCGCAGG + Intergenic
1168056508 19:53867829-53867851 CGCCCCCGTCCCGCCCGCGCTGG + Intronic
1168352604 19:55685313-55685335 CGCCCCAGAGCCCGCGTCGCAGG + Intronic
1202712860 1_KI270714v1_random:27155-27177 CGCCGCGGCGCCTCCCGCGCGGG - Intergenic
925342493 2:3147153-3147175 CGCCCCAGAGCCTCACTCCCAGG + Intergenic
927809399 2:26173190-26173212 CGCCCCGGGGCCGCCGTCCCGGG - Exonic
930363603 2:50411667-50411689 CGCCCGGCAGCCGCCCTGTCTGG + Intronic
931584246 2:63809099-63809121 CGCCCGGCAGCCGCCCTGTCTGG + Intronic
932253805 2:70267027-70267049 CGCCCAGCAGCCGCCCTGTCTGG - Intronic
936403181 2:112181729-112181751 CTCCCCGCAGCCGCCCCCGAGGG + Exonic
936460266 2:112709161-112709183 CCCCCAGGAGCCGCCCTCCGAGG + Intergenic
939612952 2:144332346-144332368 CTCCCCGGCGCCCGCCTCGCGGG - Intronic
940817247 2:158310560-158310582 CGCCCGGCAGCCGCCCTGTCTGG - Intronic
941025134 2:160449131-160449153 CGCCCGGCAGCCGCCCCCACTGG + Intronic
942450921 2:176107633-176107655 CGCGCCGCCGCCGCCCCCGCCGG - Exonic
942463871 2:176188612-176188634 CGCCACGTGGCCGCCCCCGCCGG + Exonic
942799671 2:179861184-179861206 AGCCCCGGTGCAGCCCTGGCGGG - Exonic
943100379 2:183479394-183479416 CGCCCGGCAGCCGCCCTGTCCGG + Intergenic
945251697 2:207769953-207769975 CGCCCCGGCTCCGCCCCCTCAGG + Intergenic
947741217 2:232485820-232485842 CGCCCCGGATCCGCGGCCGCTGG + Intronic
948479339 2:238240238-238240260 CGCCCCGGTGCCGCCCCCGCGGG - Intronic
948675753 2:239595588-239595610 AGCCCCTGAGCCCCCCTCCCAGG - Intergenic
1168765703 20:380776-380798 CACCTGGGACCCGCCCTCGCTGG - Exonic
1168777750 20:462282-462304 GCCCCCCGGGCCGCCCTCGCAGG + Intronic
1169991901 20:11513422-11513444 CGCCCGGCAGCCGCCCTGTCCGG - Intergenic
1170202548 20:13760632-13760654 CGCCCGGCAGCCGCCCTGTCCGG + Intronic
1170890100 20:20368885-20368907 CGCCGCGGAGCCGCCCGCCAAGG + Exonic
1171848483 20:30291850-30291872 CGCCCGGCAGCCGCCCTGTCTGG - Intergenic
1172739074 20:37151200-37151222 CGCCCGGCAGCCGCCCTGTCCGG + Intronic
1172910779 20:38407598-38407620 CGCCCAGCAGCCGCCCTGTCCGG + Intergenic
1173273168 20:41555469-41555491 CGCCCGGCAGCCGCCCTGTCTGG - Intronic
1173913531 20:46689091-46689113 AGCCTCGGGGCCGCCCACGCCGG + Intronic
1174343785 20:49915143-49915165 CGGCCCTGAGCCACCCTCGGCGG + Intronic
1176132508 20:63502307-63502329 CACCCCGGGGCCACCGTCGCAGG + Intergenic
1176178569 20:63739603-63739625 CGCCCCGGGCCCGCCCCCTCCGG - Intronic
1180042657 21:45288132-45288154 CGCCCTGGCGCAGCCCACGCAGG + Intergenic
1180049294 21:45324067-45324089 CTCCCCTGGGCCACCCTCGCTGG + Intergenic
1180187246 21:46145836-46145858 CGCCACCGAGCCGCCCCCGGGGG + Exonic
1180215913 21:46323828-46323850 AGCCCAGGGGCCGCCCGCGCGGG + Exonic
1180285543 22:10741798-10741820 CGGCCCTGGGCCGCCCTCCCGGG - Intergenic
1180852742 22:19029676-19029698 CGGCCCGGAGCTGGCCGCGCAGG - Intergenic
1181230131 22:21417245-21417267 CGGCCCGGCCCCGCCCCCGCAGG + Intergenic
1181248518 22:21517621-21517643 CGGCCCGGCCCCGCCCCCGCAGG - Intergenic
1181514339 22:23402605-23402627 CGCCCCCGGCCCGCCCTGGCCGG - Intergenic
1182494305 22:30695275-30695297 CGCATCGGAGCCGCTCTCCCGGG + Exonic
1182639302 22:31753914-31753936 CGCCCCCGCGCCGCTCTCGCCGG - Intergenic
1183264444 22:36816797-36816819 CGCCCCCGCCCCGACCTCGCCGG + Intronic
1184046690 22:41976661-41976683 GGTCCAGGAGCCGCCCCCGCGGG - Intronic
1184160351 22:42693909-42693931 CGCCCCGGAGCAGCCGCAGCAGG + Exonic
1184766995 22:46577234-46577256 CGCCGCGGCGCCCCCCTCGCCGG - Intronic
1185055185 22:48575633-48575655 CGCCCCTGGGCTGCCCACGCTGG - Intronic
1185381298 22:50508478-50508500 CGCCCCGCAGCCCCACCCGCCGG - Intronic
949551130 3:5113813-5113835 CGCCCGGCAGCCGCCCTGTCCGG - Intergenic
950469319 3:13174760-13174782 CCCCTCAGAGCTGCCCTCGCTGG + Intergenic
950683915 3:14603024-14603046 GGCCCCGGCCCCGCCCCCGCCGG + Intergenic
952764690 3:36944409-36944431 TGCCCCGGGGGCGCGCTCGCTGG + Intronic
954277914 3:49554541-49554563 CGCCCGGGAGCCGCCGGCCCGGG + Exonic
957646750 3:82939905-82939927 AGCCCAGGAGCCGCCCGCCCAGG + Intergenic
961012924 3:123448156-123448178 CGCCCGGGTGCTGCCCCCGCTGG + Exonic
961037452 3:123652544-123652566 CGCCCCGGAGACGGCCTCTGAGG + Intronic
962787923 3:138785031-138785053 CGCCCCGCAGCCGCCCCGTCTGG + Intronic
967316289 3:188154322-188154344 CACCCCGGAGGCGCTCGCGCCGG - Intronic
968353404 3:198080971-198080993 CGCCCCGGTGCAGCCGCCGCCGG + Intergenic
968452897 4:683468-683490 CACCCCGGGGCCACCCTGGCTGG + Intronic
968764730 4:2462470-2462492 GGCCCCGGCGGCGCCCTCGCAGG + Exonic
968879945 4:3293431-3293453 CTGCCCGGCGCCGCCCCCGCGGG - Intronic
970574536 4:17414362-17414384 CGCGCCCGAGCCTCCCTCACGGG - Intergenic
972270741 4:37509278-37509300 CGCCCAGCAGCCGCCCTGTCTGG - Intronic
975795948 4:78007242-78007264 CGCCCCGCAGCCGCCCTGTCTGG - Intergenic
976246785 4:83012756-83012778 CGCCCAGGAGCCCCCATCCCGGG + Intronic
977536701 4:98261864-98261886 CACCACGGAGCCTGCCTCGCGGG + Intronic
978947536 4:114516699-114516721 CGCCCCGCAGCCACCCTGTCCGG + Intergenic
983664410 4:170166234-170166256 CGCCCGGCAGCCGCCCTGTCTGG - Intergenic
985247990 4:187995966-187995988 CAGGCCGGAGCCGGCCTCGCCGG + Intronic
985660564 5:1155081-1155103 CGCCCCCGCCCCGCCCTCCCAGG + Intergenic
989574749 5:42979452-42979474 CGCCCAGCAGCCGCCCTGTCTGG + Intergenic
989574761 5:42979492-42979514 CGCCCGGCAGCCGCCCTGTCCGG + Intergenic
990381949 5:55227437-55227459 CCCCCGGGAGCCGCCAGCGCGGG + Intergenic
992415805 5:76551084-76551106 CGCCCCGCAGCCGCCCCGTCTGG - Intronic
997248222 5:132369698-132369720 CGCCCCAGCTCCGCCTTCGCCGG + Intergenic
997652914 5:135535549-135535571 CGCTTCGGGGCCGCCCGCGCCGG - Exonic
998154220 5:139775280-139775302 CGCCCCCGCGCGGCCCTCCCAGG - Intergenic
998236396 5:140402048-140402070 GGCCTCGGAGCCGCCTCCGCCGG + Exonic
999455635 5:151714044-151714066 CGCCCCGCAGCCGCCCCGTCCGG - Intergenic
999532639 5:152480008-152480030 CGCCCGGCAGCCGCCCTGTCTGG - Intergenic
1000032956 5:157419746-157419768 CGCCCGGCAGCCGCCCTGTCTGG + Intronic
1002058035 5:176609908-176609930 CGCCCCGGAGCCGCTGTCCAGGG - Intronic
1002303926 5:178272621-178272643 CTCCCAGGAGCTGCCCTAGCTGG + Intronic
1002405028 5:179023915-179023937 CGCCCCGGGCCCGCCCTCACCGG - Intronic
1002887890 6:1312265-1312287 TGCCCCGAAGACGCCCGCGCGGG + Intergenic
1003367072 6:5484985-5485007 GGCCCCGGAGGAGCCCTCCCTGG + Intronic
1003544898 6:7051435-7051457 CGCGCCGCAGCCGCCCTCGGGGG - Intergenic
1004152489 6:13134092-13134114 CGCCCGGCAGCCGCCCTGTCTGG + Intronic
1006366768 6:33620932-33620954 CACCCCGGAGCCGCTCGCGGAGG - Exonic
1008553736 6:52656078-52656100 CGCCCGGCAGCCGCCCTGTCCGG - Intergenic
1011426821 6:87239547-87239569 CGCCCGGCAGCCGCCCTGTCCGG - Intronic
1013441778 6:110179166-110179188 CGCCCCGGGGCTGCTCTCGCTGG - Intronic
1014272542 6:119349857-119349879 CGCCTCGGCCCCGCCCCCGCGGG - Intergenic
1014800358 6:125770995-125771017 CGCCCGGCAGCCGCCCCCTCCGG + Intergenic
1016062347 6:139643977-139643999 GGCCCAGGAGCCGTCCTCACTGG - Intergenic
1017324579 6:153130965-153130987 CGCCGCGCAGCCGCCCCCGCCGG + Intronic
1017981912 6:159407457-159407479 CGCCCGGCAGCCGCCCCCTCTGG + Intergenic
1018727979 6:166627920-166627942 CGGCCAGGAGCCGCCCTCCGCGG + Intronic
1019542882 7:1559476-1559498 CGCCCAGGAGCCGCCTCCTCAGG + Intronic
1019765118 7:2844218-2844240 CGGCCCGGGCTCGCCCTCGCCGG - Exonic
1020046704 7:5046056-5046078 AGCCCCGGAGCCGGCGGCGCTGG + Exonic
1020461619 7:8434648-8434670 CGCCCCGGACGTGCCCTCCCAGG - Exonic
1022410344 7:30135026-30135048 GGCCCCGGAGGAGCCCGCGCAGG + Exonic
1024062807 7:45711271-45711293 AGCCCTGCAGCCACCCTCGCTGG + Intronic
1030706364 7:112697384-112697406 CGCCCGGCAGCCGCCCTGTCCGG - Intergenic
1031966488 7:128031396-128031418 CGGCCCGGAGCGGCCGACGCCGG - Intronic
1032117090 7:129126591-129126613 TGCCTCGGAGGCGCCCTCGCTGG - Intergenic
1033220487 7:139523936-139523958 GGCCCGGGAGCCCCCCTCGCGGG + Exonic
1033299949 7:140176704-140176726 AGCCCCGCAGCCGCCACCGCCGG - Intronic
1034412157 7:150947371-150947393 CGCCCCGGGGCCGCCGACCCGGG + Exonic
1035266813 7:157693683-157693705 CTGCCCGGAGCCGGCCTGGCCGG - Intronic
1035404259 7:158587836-158587858 CGCCCCGGCCCCGCCCCCGGCGG + Intergenic
1035573314 8:688197-688219 GGCCCCTGAGCCGCCCACGCAGG + Intronic
1035612042 8:973311-973333 CGCCCGGCAGCCGCCCTGTCTGG - Intergenic
1037273784 8:17156665-17156687 CGCCCCGGAGCCAGGCCCGCGGG + Exonic
1039885921 8:41653920-41653942 CGCCCCGGGGCCTGCCTGGCCGG + Intronic
1040415127 8:47188835-47188857 CTCCCGGGAGCCGCCATCGCTGG + Intergenic
1041167366 8:55102739-55102761 CGCCCCGCCGCCGCCCGGGCCGG - Exonic
1042271816 8:66962614-66962636 CGCCCCCGAGCCCGCCCCGCCGG - Intergenic
1046077941 8:109334552-109334574 CGTCCCCGACCCGCGCTCGCGGG + Intronic
1047100166 8:121667535-121667557 CGCCCCCGCCCCGCCCCCGCCGG - Intergenic
1047292285 8:123541108-123541130 CGCCCCGCCGCCCCCGTCGCGGG - Exonic
1049614277 8:143569323-143569345 CGCCCAGGCCCCGCCCTCTCAGG - Intronic
1049725203 8:144142562-144142584 GGCCCAGGTGCCGCCCTCACTGG + Intergenic
1049818945 8:144622495-144622517 GTGCCCGGAGCCGCCCTCCCAGG + Intergenic
1052192741 9:25677947-25677969 CGTCCCGTTGCCGCCTTCGCCGG + Exonic
1055090980 9:72364785-72364807 CGCCCTGGTGCCGCCGCCGCGGG + Intronic
1055454350 9:76459155-76459177 CGCCCCGGGGCCGCCCCCAGAGG - Intronic
1055770191 9:79708685-79708707 AGCCCCGGAGCGGCCTACGCTGG + Exonic
1056786096 9:89593556-89593578 TGCCCCTGAGCAGTCCTCGCTGG - Intergenic
1060758207 9:126227808-126227830 CGACCTGGAGCTGCCCGCGCTGG + Intergenic
1061441760 9:130609450-130609472 CCCCCTGGTGCCCCCCTCGCCGG - Intronic
1061450771 9:130665961-130665983 AGCCCGGGCGCCGCCCTCCCTGG + Intronic
1061453555 9:130681770-130681792 CGCCGCGGAGCCCCGCGCGCTGG + Exonic
1062044324 9:134418078-134418100 CGCCCCTGTGCTGCCCTCCCTGG - Intronic
1062542037 9:137045823-137045845 CGCCCCGGGGCCGGGATCGCCGG - Intronic
1203731898 Un_GL000216v2:98864-98886 CGGCCCTGGGCCGCCCTCCCGGG - Intergenic
1187826102 X:23334533-23334555 CGGCGCGGAGCCCCCCTGGCGGG + Exonic
1190287584 X:48971374-48971396 AGCCCAGGAGCCCCCCTCCCTGG - Exonic
1192549382 X:72041930-72041952 CGCTCGGGAGCCACCCACGCTGG + Intergenic
1198214917 X:134546553-134546575 TGCTCCTGAGCCGGCCTCGCGGG + Intergenic
1200787531 Y:7273707-7273729 CTCCCCGGAGTCGCACTGGCGGG - Intergenic