ID: 1070164644

View in Genome Browser
Species Human (GRCh38)
Location 10:73888480-73888502
Sequence GCAACTTGTCAGAATAAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070164644_1070164649 21 Left 1070164644 10:73888480-73888502 CCTCCTTTATTCTGACAAGTTGC No data
Right 1070164649 10:73888524-73888546 CTTAAACCAGTCTTGAGCCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070164644 Original CRISPR GCAACTTGTCAGAATAAAGG AGG (reversed) Intergenic
No off target data available for this crispr