ID: 1070165453

View in Genome Browser
Species Human (GRCh38)
Location 10:73894228-73894250
Sequence ATGGGGAGCTTCAGCCACCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070165453_1070165463 26 Left 1070165453 10:73894228-73894250 CCTGGGTGGCTGAAGCTCCCCAT No data
Right 1070165463 10:73894277-73894299 CATGAGTTCAAAACCAGCATGGG No data
1070165453_1070165462 25 Left 1070165453 10:73894228-73894250 CCTGGGTGGCTGAAGCTCCCCAT No data
Right 1070165462 10:73894276-73894298 CCATGAGTTCAAAACCAGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070165453 Original CRISPR ATGGGGAGCTTCAGCCACCC AGG (reversed) Intergenic
No off target data available for this crispr