ID: 1070168795

View in Genome Browser
Species Human (GRCh38)
Location 10:73916898-73916920
Sequence GCCTCACAAATGCCCACCGT CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 101
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 93}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070168795_1070168799 11 Left 1070168795 10:73916898-73916920 CCGACGGTGGGCATTTGTGAGGC 0: 1
1: 0
2: 0
3: 7
4: 93
Right 1070168799 10:73916932-73916954 AAATGAATAATTTCCCAATTAGG 0: 1
1: 1
2: 2
3: 47
4: 455
1070168795_1070168802 28 Left 1070168795 10:73916898-73916920 CCGACGGTGGGCATTTGTGAGGC 0: 1
1: 0
2: 0
3: 7
4: 93
Right 1070168802 10:73916949-73916971 ATTAGGAAGTGTAACAGCTGAGG 0: 1
1: 0
2: 1
3: 15
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070168795 Original CRISPR GCCTCACAAATGCCCACCGT CGG (reversed) Exonic
905302468 1:36995063-36995085 GCTTCACAGATGCCCACCAGAGG + Intronic
913356005 1:117922941-117922963 GCCTCTGAAATGTCCACCGTGGG - Intronic
1066331389 10:34427333-34427355 GCCTCTCAAATGGCCACCCTGGG + Intronic
1069457156 10:68561830-68561852 GGATCAGAAATGCCCAGCGTGGG - Intronic
1069771769 10:70904993-70905015 TCCTCACAAATGCCCCACGAAGG + Intergenic
1070168795 10:73916898-73916920 GCCTCACAAATGCCCACCGTCGG - Exonic
1070761183 10:79025322-79025344 GACACACACATGCCCAGCGTGGG + Intergenic
1070849765 10:79553991-79554013 GCCTCACAATGGTTCACCGTAGG + Intergenic
1074732507 10:116393651-116393673 GCCGCACAGGAGCCCACCGTAGG - Intergenic
1075157400 10:119989517-119989539 TCCTCACAATTTCCCACAGTTGG - Intergenic
1076779017 10:132713825-132713847 TGCTCTCAACTGCCCACCGTAGG + Intronic
1077069177 11:660040-660062 GCTTCACCAATGCCCACCATGGG + Intronic
1077172901 11:1176318-1176340 GGCTCACCACTGCCCACCCTGGG - Intronic
1079182868 11:18209188-18209210 GCCGGACAAATACCCACCGCAGG - Exonic
1087682306 11:101231411-101231433 GCCACACAAGAGCCCACAGTGGG + Intergenic
1092218424 12:6697828-6697850 CCCTCACATAGGCCCACAGTAGG - Intronic
1094385079 12:29885284-29885306 GCCTCTAAAATGGCCACCCTGGG - Intergenic
1095528997 12:43162274-43162296 GCTTCACAAATGCACACCACTGG + Intergenic
1095600076 12:44003425-44003447 GCCTCACAAATGCACACAGGTGG + Intronic
1098467821 12:70808089-70808111 GCCTCTGAAATGGCCACCCTGGG + Intronic
1099566503 12:84254866-84254888 GCTTGACAAATGACAACCGTGGG + Intergenic
1101431128 12:104628281-104628303 GCCTCACAAATGCTGACAGGTGG + Intronic
1104166204 12:126232107-126232129 GCCTCACGTATGCCCTCAGTTGG - Intergenic
1110483494 13:76011421-76011443 GACTCACAAATGCCCAGCCTGGG - Intergenic
1202854754 14_GL000225v1_random:43407-43429 GCCTCACGAAAGCCCCCTGTGGG - Intergenic
1202864269 14_GL000225v1_random:104948-104970 GTCTCACAAAAGCCCCCTGTGGG + Intergenic
1128150939 15:65363195-65363217 GCCCCACAAAAGCCCACAGGTGG + Intronic
1132617174 16:847441-847463 GCTTCACAGTAGCCCACCGTGGG + Intergenic
1133305200 16:4804115-4804137 GCCTAAGAAATGCTCATCGTTGG + Exonic
1136245567 16:28974090-28974112 GCCCTACAAAAGCCCACCGGAGG + Intergenic
1136295972 16:29302191-29302213 GCCTGGCAACTGCCCACCCTGGG + Intergenic
1136397032 16:29998665-29998687 GGCCCACAAATGCCTACCTTAGG - Intronic
1139954503 16:70686625-70686647 GCCCCCCAAATGCCCAGCCTTGG - Intergenic
1142101892 16:88276378-88276400 GCCTGGCAACTGCCCACCCTGGG + Intergenic
1142230008 16:88895688-88895710 GCCTCACAGATACCCACTGCAGG + Intronic
1145797683 17:27665508-27665530 GACTCCCAAATGCCCTCTGTAGG + Intergenic
1145812115 17:27770808-27770830 GACTCCCAAATGTCCTCCGTAGG + Intronic
1145962632 17:28896596-28896618 GCCTCACAGCTGCCAACCCTTGG - Intronic
1146168055 17:30607198-30607220 GCCTAAAAAATGCCCACCCCCGG - Intergenic
1146842151 17:36163691-36163713 GACTCCCAAATGCCCTCCATAGG + Intergenic
1146854459 17:36251650-36251672 GACTCCCAAATGCCCTCCATAGG + Intronic
1146866158 17:36336726-36336748 GACTCCCAAATGCCCTCCATAGG - Intronic
1146870361 17:36375542-36375564 GACTCCCAAATGCCCTCCATAGG + Intronic
1146877718 17:36426623-36426645 GACTCCCAAATGCCCTCCATAGG + Intronic
1147069029 17:37937338-37937360 GACTCCCAAATGCCCTCCATAGG - Intergenic
1147073243 17:37976166-37976188 GACTCCCAAATGCCCTCCATAGG + Intergenic
1147084764 17:38055704-38055726 GACTCCCAAATGCCCTCCATAGG + Intronic
1147096500 17:38140835-38140857 GACTCCCAAATGCCCTCCATAGG - Intergenic
1147100712 17:38179670-38179692 GACTCCCAAATGCCCTCCATAGG + Intergenic
1150083647 17:62262717-62262739 GACTCCCAAATGCCCTCCATAGG + Intergenic
1150366728 17:64594440-64594462 GCCTAAAAAATGCCCACCCCAGG + Intronic
1155320144 18:24611175-24611197 GCCACACACAGGCCCACCGTTGG + Intergenic
1156017152 18:32559715-32559737 GCCTCAAAATTGCCCACCCGAGG + Intergenic
1157828251 18:50832149-50832171 ACATCACAAATGCCCAGGGTAGG - Intergenic
1158871746 18:61694723-61694745 CCTTCCCAAAGGCCCACCGTAGG + Intergenic
1163347069 19:16750004-16750026 GCCTCTCAACTGCCCCCCGAGGG + Exonic
1166422585 19:42650468-42650490 GCCTCACAAAGGCTCACACTGGG - Intronic
926286783 2:11494934-11494956 GCCTCAGAGGTGCTCACCGTTGG + Intergenic
929950960 2:46409158-46409180 GCCTCACAATAGCCCAGCGAGGG - Intergenic
930171758 2:48258711-48258733 GACTTACAAATGCCCATCATTGG + Intergenic
931578492 2:63746603-63746625 GCCTCTAAAATGGCCACCCTGGG + Intronic
932263789 2:70348791-70348813 GCTTCCCAAATGCCCACCAATGG + Intergenic
939084221 2:137697758-137697780 GCCACATAAATGCCCACCAGAGG + Intergenic
939790625 2:146569810-146569832 GCATAACAAAAGCCCACCTTTGG + Intergenic
1170571322 20:17634422-17634444 GCCACACCAAAGCCCACTGTAGG + Intronic
1173420579 20:42897614-42897636 CCCCCAGAAATGCCCACCTTGGG + Intronic
1176914634 21:14610265-14610287 GCCTCTAAAATGGCCACCCTAGG + Intronic
1181359744 22:22325166-22325188 GACTCACAAATCTCCATCGTGGG + Intergenic
1182294508 22:29305238-29305260 GCCGGACACATGCCCACCATGGG + Intergenic
1185020862 22:48374060-48374082 GGATCACAAATGCCCACCCGGGG - Intergenic
950258153 3:11522756-11522778 GCCTGTCAAATGCCCACCCCAGG + Intronic
952482412 3:33775197-33775219 GCCTCAAAATTGCCAACCCTGGG + Intergenic
956131348 3:66056555-66056577 GCCTCAAAAATGGCCCCCTTGGG - Intergenic
957756255 3:84492069-84492091 GCCTCTAAAATGGCCACCCTGGG + Intergenic
959560083 3:107769356-107769378 GCCTCACAACAGCCCAATGTAGG + Intronic
964196216 3:154067897-154067919 GCCTCTAAAATGCCCCCCTTCGG + Intergenic
971365813 4:25976353-25976375 GCCTCTAAAATGGCCCCCGTGGG + Intergenic
973135291 4:46699138-46699160 GCCACACAGGAGCCCACCGTGGG - Intergenic
973969188 4:56194207-56194229 GGCTTACAAATGCCCGCTGTTGG - Intronic
985826949 5:2199617-2199639 CTCACACACATGCCCACCGTTGG + Intergenic
988046976 5:25969181-25969203 GCCTCTAAAATGGCCACCCTGGG + Intergenic
988855556 5:35224931-35224953 GCATCACAAAAGACCACCTTTGG - Intronic
989828672 5:45889684-45889706 GCCTCAAAAATGGCCACTCTAGG - Intergenic
1006845419 6:37058019-37058041 GTATCATAACTGCCCACCGTGGG + Intergenic
1007957331 6:45929691-45929713 GCCTGATAACAGCCCACCGTGGG + Intronic
1017854637 6:158339544-158339566 GCCTCTAAAATGGCCACCCTAGG - Intronic
1018714145 6:166518939-166518961 ACCTCACCATTGCCCACCCTAGG + Intronic
1019825949 7:3284476-3284498 GCCTCAAAAATGCACACAGGAGG - Intergenic
1022686773 7:32604333-32604355 GCCTCTAAAATGGCCACCCTGGG - Intergenic
1024891967 7:54213416-54213438 GCCTCTAAAATGGCCACCCTGGG - Intergenic
1033488597 7:141817325-141817347 GCTTGACAAATGCCAACCATTGG + Intergenic
1037204246 8:16294785-16294807 GCCTCTAAAATGGCCACCGTGGG + Intronic
1053011888 9:34638172-34638194 GCCTCTGGAATGCCCACCCTGGG - Intronic
1056275834 9:84993254-84993276 GACTCACAAATGCACACCTCTGG + Intronic
1062535362 9:137018840-137018862 GCCTCGCACATGCCCACGGCGGG - Intronic
1203740054 Un_GL000216v2:171068-171090 GTCTCACAAAAGCCCCCTGTGGG - Intergenic
1186031590 X:5374917-5374939 GCCACACAAATGTCCACTGGTGG - Intergenic
1195838314 X:109144206-109144228 GCCTCTAAAATGGCCACCCTGGG + Intergenic
1199360787 X:146915886-146915908 GCCTCTAAAATGGCCACCCTGGG - Intergenic
1199844561 X:151681292-151681314 GACTGACAAATTCCCACCCTTGG + Intergenic
1200979347 Y:9247905-9247927 TCCACACAAATGCCCACCTGAGG - Intergenic