ID: 1070168856

View in Genome Browser
Species Human (GRCh38)
Location 10:73917372-73917394
Sequence CATCCAATCCTCACTGGGTG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 4, 3: 6, 4: 151}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070168846_1070168856 15 Left 1070168846 10:73917334-73917356 CCTTTCTTGGCCAGTTATCCCTT 0: 1
1: 1
2: 0
3: 14
4: 212
Right 1070168856 10:73917372-73917394 CATCCAATCCTCACTGGGTGGGG 0: 1
1: 0
2: 4
3: 6
4: 151
1070168849_1070168856 -4 Left 1070168849 10:73917353-73917375 CCTTCCTTTTAGCCTAGTTCATC 0: 1
1: 0
2: 0
3: 15
4: 143
Right 1070168856 10:73917372-73917394 CATCCAATCCTCACTGGGTGGGG 0: 1
1: 0
2: 4
3: 6
4: 151
1070168847_1070168856 5 Left 1070168847 10:73917344-73917366 CCAGTTATCCCTTCCTTTTAGCC 0: 2
1: 0
2: 15
3: 41
4: 385
Right 1070168856 10:73917372-73917394 CATCCAATCCTCACTGGGTGGGG 0: 1
1: 0
2: 4
3: 6
4: 151
1070168845_1070168856 16 Left 1070168845 10:73917333-73917355 CCCTTTCTTGGCCAGTTATCCCT 0: 1
1: 0
2: 2
3: 16
4: 181
Right 1070168856 10:73917372-73917394 CATCCAATCCTCACTGGGTGGGG 0: 1
1: 0
2: 4
3: 6
4: 151
1070168848_1070168856 -3 Left 1070168848 10:73917352-73917374 CCCTTCCTTTTAGCCTAGTTCAT 0: 1
1: 0
2: 2
3: 27
4: 236
Right 1070168856 10:73917372-73917394 CATCCAATCCTCACTGGGTGGGG 0: 1
1: 0
2: 4
3: 6
4: 151
1070168850_1070168856 -8 Left 1070168850 10:73917357-73917379 CCTTTTAGCCTAGTTCATCCAAT 0: 1
1: 0
2: 0
3: 13
4: 143
Right 1070168856 10:73917372-73917394 CATCCAATCCTCACTGGGTGGGG 0: 1
1: 0
2: 4
3: 6
4: 151

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070168856 Original CRISPR CATCCAATCCTCACTGGGTG GGG Exonic
900604526 1:3517924-3517946 CATCAAACCCCCACTGGGTGGGG - Intronic
901912109 1:12467458-12467480 TATCTGATCCTGACTGGGTGTGG - Intronic
907149427 1:52269418-52269440 TATCCAATCCTGATAGGGTGTGG - Intronic
908787048 1:67745484-67745506 CATCCAAGCCCCACAGGGTCTGG + Intronic
908977787 1:69919828-69919850 CCCCCAATCCTCACTCCGTGCGG - Intronic
909089253 1:71205382-71205404 CACCCCATTCTCTCTGGGTGTGG + Intergenic
910766029 1:90783138-90783160 CATCCAAGCCTCTCTGGGGAAGG + Intergenic
913496124 1:119429864-119429886 CAGGGAATCCTCAGTGGGTGGGG + Intergenic
916849010 1:168683928-168683950 GACCCATCCCTCACTGGGTGGGG - Intergenic
924458725 1:244239317-244239339 AATCTAATCCTCACTGCCTGAGG + Intergenic
1067164207 10:43852401-43852423 CATACAGTCCTCCCTTGGTGTGG + Intergenic
1070168856 10:73917372-73917394 CATCCAATCCTCACTGGGTGGGG + Exonic
1070833825 10:79435870-79435892 CATCCAGTCCCCACAGGCTGTGG - Intronic
1071505990 10:86231924-86231946 CAACAAATGCTCATTGGGTGAGG + Intronic
1071717533 10:88112503-88112525 AATGCAATCCTGGCTGGGTGTGG + Intergenic
1075680004 10:124324989-124325011 CATCACAGCCTCACTGGCTGAGG - Intergenic
1077684434 11:4277732-4277754 AAATCAATCCTGACTGGGTGGGG + Intergenic
1077685606 11:4289036-4289058 AAATCAATCCTGACTGGGTGGGG - Intergenic
1078974111 11:16451403-16451425 CATCCAATCTTCAGTTGCTGTGG - Intronic
1079335511 11:19567264-19567286 CCTCCAATCCTCACCCAGTGTGG - Intronic
1080932132 11:36821934-36821956 CATCCAATCCTCACTGGTGTGGG - Intergenic
1081014843 11:37863905-37863927 CATCCCATCCTCACTCGCAGAGG - Intergenic
1089575688 11:119441440-119441462 CAGCCTTTCCTCACTGGGGGTGG + Intergenic
1096798995 12:54096964-54096986 CCTCCACTCCAGACTGGGTGGGG - Intergenic
1099174279 12:79402692-79402714 CATTAAATCCTCAGTGTGTGAGG + Intronic
1099738881 12:86605112-86605134 TTGCCAATCCTCACAGGGTGTGG + Intronic
1101179066 12:102190677-102190699 CATCCCCTCCTTACAGGGTGAGG - Intronic
1101513322 12:105411918-105411940 CTTCCATCCCTCACTGGCTGAGG + Intergenic
1103303475 12:119945957-119945979 CTCCCATCCCTCACTGGGTGAGG - Intergenic
1106642109 13:31595793-31595815 CATCCACCCTTCCCTGGGTGGGG - Intergenic
1107880141 13:44825549-44825571 CTCCCATTCCTCACTGGTTGAGG + Intergenic
1109278421 13:60327728-60327750 CAGCCAATCCTCACTGGATGTGG - Intergenic
1110012067 13:70349191-70349213 CATCCAATTTTCAATGGATGTGG - Intergenic
1110898235 13:80784394-80784416 CATCAAATGTTTACTGGGTGGGG + Intergenic
1111698816 13:91660443-91660465 TCTCCAAGCTTCACTGGGTGAGG - Intronic
1113559986 13:111271127-111271149 GCTCCAAACATCACTGGGTGGGG - Intronic
1113716890 13:112516373-112516395 CCTCCAGCCCCCACTGGGTGCGG - Intronic
1116671301 14:47846211-47846233 GATCCACTCCTCACTGGGTGGGG + Intergenic
1120903836 14:89601797-89601819 CATCTAATCCTCTCTGGGGCAGG + Intronic
1121765441 14:96481634-96481656 AATGCATTTCTCACTGGGTGTGG - Intronic
1123689055 15:22822011-22822033 CAACCACTCCTCACAAGGTGTGG - Intronic
1123991480 15:25686933-25686955 CAGCCAATCTGCCCTGGGTGTGG + Intronic
1124563295 15:30794420-30794442 CACCCAGTCCCCACTGTGTGAGG - Intergenic
1126287256 15:47027371-47027393 CAGGCAAGCCTCACTGGGTTGGG + Intergenic
1127775651 15:62262328-62262350 CATCCAACCCCCACTGTGGGAGG + Intergenic
1128366777 15:67009770-67009792 CATCAAACCCTGAATGGGTGGGG + Intergenic
1131843105 15:96458942-96458964 CATCTAAGCCTCAGTGGCTGAGG + Intergenic
1135402227 16:22174040-22174062 ATTATAATCCTCACTGGGTGCGG + Intronic
1137728825 16:50675028-50675050 CATTTAATCCTCACTGGGTGAGG - Intronic
1140475867 16:75238981-75239003 CATCCCAACCTCACGCGGTGAGG + Intronic
1203141956 16_KI270728v1_random:1772513-1772535 CGTCCCAACCACACTGGGTGTGG - Intergenic
1143044155 17:4063297-4063319 TATCAAATCCTGGCTGGGTGTGG + Intronic
1145108502 17:20140862-20140884 CAAGCACTCCTCACTGGTTGAGG + Intronic
1146122162 17:30205297-30205319 CATCATTTCCTCACTGCGTGGGG + Intronic
1146425513 17:32733697-32733719 CAACAAATCCCCACAGGGTGAGG + Intronic
1148397018 17:47317073-47317095 AATACAATCCCCACTGGGTGTGG - Intronic
1150003106 17:61454387-61454409 CATCCACTCCTCCGCGGGTGCGG - Intronic
1152313943 17:79568909-79568931 CAGCACATCCTCACTGGGTCCGG - Intergenic
1153262118 18:3234606-3234628 CGCCCACTCCTCACTGTGTGTGG - Intergenic
1154502146 18:15002353-15002375 GATGCCATCCTCTCTGGGTGAGG + Intergenic
1155311979 18:24532918-24532940 CACCCAGTCCTCCCAGGGTGGGG + Intergenic
1157625961 18:49051430-49051452 CTTCCAATTCTGACTAGGTGTGG + Intronic
1159219908 18:65447227-65447249 CCTCCATTCCTCACTGGCTGTGG - Intergenic
1164657404 19:29933528-29933550 CATCAACTTTTCACTGGGTGTGG + Intronic
1166060683 19:40323619-40323641 CATCCTATCCTGACAGGGAGAGG + Intronic
1166384174 19:42370936-42370958 CATCCTCTCCTGACTGGGGGTGG - Intronic
1167831020 19:52022849-52022871 CTTCCATTCCTCTCTGCGTGTGG + Intronic
926139537 2:10360001-10360023 CATTCATTCTTCACTGTGTGGGG + Intronic
926459201 2:13108267-13108289 CATCCTATACTCAATGGGAGGGG - Intergenic
935148399 2:100412243-100412265 CATCCCATCATCTCTGGCTGTGG + Intronic
937292586 2:120790556-120790578 CAGCCATTCCACACTGGGAGGGG - Intronic
938501230 2:131832129-131832151 CATGCAGCCCCCACTGGGTGTGG - Intergenic
938501324 2:131832525-131832547 GATGCCATCCTCTCTGGGTGAGG + Intergenic
941923078 2:170870976-170870998 TGTACAATCCTAACTGGGTGGGG - Intergenic
947959161 2:234220422-234220444 CATACCATCCCCTCTGGGTGAGG - Intergenic
1170033315 20:11965184-11965206 AATCCAATCATCTCTGGGTGGGG + Intergenic
1170539542 20:17374297-17374319 CCTGCAATCCTCACTGGATTGGG - Intronic
1170762701 20:19264799-19264821 CTTCCGTTCCTCACTAGGTGAGG - Intronic
1171135178 20:22688991-22689013 CATCCACCCATCACTGGGTAAGG - Intergenic
1171797430 20:29577385-29577407 CCTCCACTCCAGACTGGGTGGGG + Intergenic
1171850821 20:30306776-30306798 CCTCCACTCCAGACTGGGTGGGG - Intergenic
1172190061 20:33056543-33056565 CATCCAGAACTCACTGGTTGGGG + Exonic
1173396613 20:42686304-42686326 CTTCCATCCCTCACTGGGTAAGG - Intronic
1173618117 20:44416037-44416059 CACCCAAACCTCCCTGGCTGGGG + Intronic
1174907006 20:54562039-54562061 CATCCAATGCACTCTGGGTAGGG + Intronic
1175784136 20:61701520-61701542 ATGCCCATCCTCACTGGGTGGGG + Intronic
1176298776 21:5088642-5088664 GACCCCATCCTCACTGGCTGTGG - Intergenic
1179248111 21:39650542-39650564 AAACCATTCCTCCCTGGGTGGGG + Intronic
1179858250 21:44173307-44173329 GACCCCATCCTCACTGGCTGTGG + Intergenic
1183726851 22:39594662-39594684 CTCCCACTCCTCTCTGGGTGGGG + Intronic
1184141087 22:42577714-42577736 GAGCCCATCCTCACTGTGTGTGG - Intergenic
955567983 3:60270265-60270287 CAACAAAGCCTCACTGGGGGAGG - Intronic
960043533 3:113174354-113174376 CATTTAATCCTCACTCTGTGAGG + Intergenic
960867444 3:122216199-122216221 CATCAAATCCTAACTGGGTGAGG + Intronic
966817410 3:183900534-183900556 CATCCTATCCTCAAGGGGAGGGG - Intergenic
969614156 4:8242593-8242615 CAGCCATTCCTCTCGGGGTGGGG + Intergenic
969947710 4:10801472-10801494 CCTCCCATCCTCACAGGGAGAGG + Intergenic
978282511 4:107035459-107035481 CATCAAGTCCTCTCTGGGCGGGG - Exonic
980645325 4:135635976-135635998 GATCCATTCCTCACTCTGTGGGG - Intergenic
985104423 4:186486792-186486814 GATCCAATCTTCACTGCCTGTGG - Intronic
985393521 4:189516259-189516281 CATCCTCACCTCACTGGGAGAGG + Intergenic
986010269 5:3707866-3707888 CAGCGAGTCTTCACTGGGTGAGG - Intergenic
989032827 5:37136824-37136846 CATCCTATCCTCTCTAGCTGTGG - Intronic
990352380 5:54931630-54931652 TATTCACTCCTCACTGGTTGAGG - Intergenic
994211732 5:97094778-97094800 CAGCTGATCATCACTGGGTGAGG + Exonic
997096913 5:130923791-130923813 CACCCTAACCTCCCTGGGTGGGG + Intergenic
997721464 5:136081049-136081071 CAGCAAATCCTCTTTGGGTGGGG + Intergenic
1000874568 5:166620095-166620117 CATCCAAATCTCACTGTGTTTGG - Intergenic
1001525223 5:172424030-172424052 CTACCCATCCTCACTGGGGGTGG + Intronic
1001706987 5:173748635-173748657 CAGGCAATCCTCAGTGGTTGGGG + Intergenic
1001745566 5:174089909-174089931 CATCTCATCCTGGCTGGGTGTGG - Intronic
1002810693 6:625295-625317 CAGCCAGGCCTCACTGTGTGTGG - Intronic
1006228151 6:32558253-32558275 CATCCAGGGCTCCCTGGGTGGGG + Intronic
1007049775 6:38815379-38815401 CCTCCATTCCCCACTGAGTGGGG - Intronic
1008706793 6:54171094-54171116 TATCCATTCCTCTCTGGGAGGGG + Intronic
1008720214 6:54339868-54339890 CATCCAAGCTTAAATGGGTGGGG + Intronic
1011260632 6:85466245-85466267 CTCCCATTCCTCACTGGTTGAGG - Intronic
1013367412 6:109446383-109446405 CATGCTATTCTCACTTGGTGTGG + Exonic
1016471520 6:144379660-144379682 CAGCCCATACTCAGTGGGTGGGG + Intronic
1017563585 6:155660423-155660445 CATCCAAACCACACAGGGGGAGG - Intergenic
1018640595 6:165900653-165900675 TAACCAATACTCACTGGGTTTGG - Intronic
1018676430 6:166226291-166226313 CTCCCCATCCTCACTAGGTGGGG - Intergenic
1019618800 7:1979478-1979500 CTTTCAATCCGCACTGGATGGGG + Intronic
1019925495 7:4189433-4189455 CAGCCACTCCCCATTGGGTGTGG - Intronic
1022721109 7:32942688-32942710 CTTCTAGTCCTCACTGGGTGGGG - Intergenic
1023255465 7:38308288-38308310 CATCACCTCCTCACTGGGAGAGG + Intergenic
1024570785 7:50721686-50721708 CACCCATTCCCCACTGGGTAGGG + Intronic
1025118780 7:56281551-56281573 CATACCATCCTCACCTGGTGTGG - Intergenic
1028900890 7:96099615-96099637 CATTGAATCCTCACATGGTGAGG + Intronic
1029171783 7:98635408-98635430 AATCTATTCCTGACTGGGTGTGG - Intergenic
1031665238 7:124475379-124475401 AAATCAATCCTGACTGGGTGGGG + Intergenic
1035757124 8:2042951-2042973 CTTCCAAAACTCCCTGGGTGAGG - Intergenic
1035863138 8:3052343-3052365 CACCAAATCCTCACAAGGTGTGG + Intronic
1041967933 8:63701931-63701953 CACTTAATGCTCACTGGGTGGGG + Intergenic
1042817357 8:72892168-72892190 GAACCAATCCTCAGTGGGAGAGG - Intronic
1043227457 8:77749355-77749377 CAGCCAACCCTCACGGGGAGAGG + Intergenic
1049223139 8:141436947-141436969 CACCCCATCTGCACTGGGTGGGG + Intergenic
1052278215 9:26702698-26702720 CATCCACTGAGCACTGGGTGTGG - Intergenic
1053788600 9:41670068-41670090 CCTCCACTCCAGACTGGGTGGGG - Intergenic
1054156538 9:61644700-61644722 CCTCCACTCCAGACTGGGTGGGG + Intergenic
1054176885 9:61881407-61881429 CCTCCACTCCAGACTGGGTGGGG - Intergenic
1054476309 9:65575709-65575731 CCTCCACTCCAGACTGGGTGGGG + Intergenic
1054660650 9:67699399-67699421 CCTCCACTCCAGACTGGGTGGGG + Intergenic
1060683063 9:125582889-125582911 CAGCCAATCATTCCTGGGTGAGG - Intronic
1060762127 9:126263403-126263425 TATCCAATCATCACTGGGCATGG + Intergenic
1061087415 9:128407192-128407214 CAGGCATTCCTCACTGGGTCAGG + Intergenic
1061169241 9:128942544-128942566 CATGGAATCCTCACTCGGAGAGG + Intronic
1061302199 9:129711832-129711854 CTTCCATTCCTTACTGGGGGAGG + Intronic
1062371957 9:136244580-136244602 CTGCCAAACCTCACTGGGTCGGG + Intronic
1062498334 9:136841993-136842015 GATGCCATCCTCTCTGGGTGAGG - Intronic
1187246309 X:17555678-17555700 CTTCCAATCCTCACTGATGGGGG + Intronic
1187706812 X:22017454-22017476 CATCCAAATCCCACTGGGTAGGG - Intergenic
1192368714 X:70496283-70496305 CAGCCAGTCCTTTCTGGGTGGGG + Intronic
1192980180 X:76330791-76330813 CAATCCCTCCTCACTGGGTGGGG + Intergenic
1193062385 X:77220345-77220367 CCATCCATCCTCACTGGGTGGGG + Intergenic
1193880507 X:86915200-86915222 CTTCCAATCCTCCCTGAGAGTGG - Intergenic
1193892545 X:87068304-87068326 CTTCCAATCCTCCCTGAGAGTGG + Intergenic
1197819440 X:130530035-130530057 CATCCAAGCCTGAGGGGGTGAGG - Intergenic
1198086531 X:133287610-133287632 CATCCAACTCTCACTGTGTTTGG + Intergenic
1199635224 X:149807021-149807043 CATCCCATCACCATTGGGTGGGG - Intergenic
1199681529 X:150227944-150227966 GATCCATTGCTGACTGGGTGAGG - Intergenic
1201326921 Y:12771085-12771107 CTTCCAAGCCTCACTGTTTGTGG - Exonic