ID: 1070171740

View in Genome Browser
Species Human (GRCh38)
Location 10:73938119-73938141
Sequence GCCAGGGAGTCCAAAGTTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070171740_1070171745 17 Left 1070171740 10:73938119-73938141 CCAGTAACTTTGGACTCCCTGGC No data
Right 1070171745 10:73938159-73938181 TTGAGTATAATATTTCTTGGTGG No data
1070171740_1070171744 14 Left 1070171740 10:73938119-73938141 CCAGTAACTTTGGACTCCCTGGC No data
Right 1070171744 10:73938156-73938178 TCATTGAGTATAATATTTCTTGG No data
1070171740_1070171746 22 Left 1070171740 10:73938119-73938141 CCAGTAACTTTGGACTCCCTGGC No data
Right 1070171746 10:73938164-73938186 TATAATATTTCTTGGTGGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070171740 Original CRISPR GCCAGGGAGTCCAAAGTTAC TGG (reversed) Intergenic
No off target data available for this crispr