ID: 1070172114

View in Genome Browser
Species Human (GRCh38)
Location 10:73940780-73940802
Sequence CCTGCTGGGCTGGCGGTGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070172104_1070172114 18 Left 1070172104 10:73940739-73940761 CCGGGCGCGGTTCTGGCTTCATC No data
Right 1070172114 10:73940780-73940802 CCTGCTGGGCTGGCGGTGAAAGG No data
1070172101_1070172114 25 Left 1070172101 10:73940732-73940754 CCGCGGCCCGGGCGCGGTTCTGG No data
Right 1070172114 10:73940780-73940802 CCTGCTGGGCTGGCGGTGAAAGG No data
1070172100_1070172114 29 Left 1070172100 10:73940728-73940750 CCTTCCGCGGCCCGGGCGCGGTT No data
Right 1070172114 10:73940780-73940802 CCTGCTGGGCTGGCGGTGAAAGG No data
1070172103_1070172114 19 Left 1070172103 10:73940738-73940760 CCCGGGCGCGGTTCTGGCTTCAT No data
Right 1070172114 10:73940780-73940802 CCTGCTGGGCTGGCGGTGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070172114 Original CRISPR CCTGCTGGGCTGGCGGTGAA AGG Intergenic
No off target data available for this crispr