ID: 1070173442

View in Genome Browser
Species Human (GRCh38)
Location 10:73950353-73950375
Sequence CAGATTCTCTCCCCGCACAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070173442_1070173446 0 Left 1070173442 10:73950353-73950375 CCAGTGTGCGGGGAGAGAATCTG No data
Right 1070173446 10:73950376-73950398 GGAAGCCAGACTGAAGAGGAAGG No data
1070173442_1070173445 -4 Left 1070173442 10:73950353-73950375 CCAGTGTGCGGGGAGAGAATCTG No data
Right 1070173445 10:73950372-73950394 TCTGGGAAGCCAGACTGAAGAGG No data
1070173442_1070173450 10 Left 1070173442 10:73950353-73950375 CCAGTGTGCGGGGAGAGAATCTG No data
Right 1070173450 10:73950386-73950408 CTGAAGAGGAAGGCTGGGTCAGG No data
1070173442_1070173449 5 Left 1070173442 10:73950353-73950375 CCAGTGTGCGGGGAGAGAATCTG No data
Right 1070173449 10:73950381-73950403 CCAGACTGAAGAGGAAGGCTGGG No data
1070173442_1070173447 4 Left 1070173442 10:73950353-73950375 CCAGTGTGCGGGGAGAGAATCTG No data
Right 1070173447 10:73950380-73950402 GCCAGACTGAAGAGGAAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070173442 Original CRISPR CAGATTCTCTCCCCGCACAC TGG (reversed) Intergenic
No off target data available for this crispr