ID: 1070173445

View in Genome Browser
Species Human (GRCh38)
Location 10:73950372-73950394
Sequence TCTGGGAAGCCAGACTGAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070173442_1070173445 -4 Left 1070173442 10:73950353-73950375 CCAGTGTGCGGGGAGAGAATCTG No data
Right 1070173445 10:73950372-73950394 TCTGGGAAGCCAGACTGAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070173445 Original CRISPR TCTGGGAAGCCAGACTGAAG AGG Intergenic
No off target data available for this crispr