ID: 1070198009

View in Genome Browser
Species Human (GRCh38)
Location 10:74176721-74176743
Sequence CCCCGCGCGCGGGCGGCCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 422
Summary {0: 1, 1: 0, 2: 8, 3: 49, 4: 364}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070198009_1070198017 18 Left 1070198009 10:74176721-74176743 CCAGGGGCCGCCCGCGCGCGGGG 0: 1
1: 0
2: 8
3: 49
4: 364
Right 1070198017 10:74176762-74176784 CAGTCGCTGAGTGCCTGAGCCGG 0: 1
1: 0
2: 0
3: 18
4: 112
1070198009_1070198018 19 Left 1070198009 10:74176721-74176743 CCAGGGGCCGCCCGCGCGCGGGG 0: 1
1: 0
2: 8
3: 49
4: 364
Right 1070198018 10:74176763-74176785 AGTCGCTGAGTGCCTGAGCCGGG 0: 1
1: 0
2: 1
3: 13
4: 182

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070198009 Original CRISPR CCCCGCGCGCGGGCGGCCCC TGG (reversed) Intronic
900190081 1:1349520-1349542 CCGCGCGCGGGGGCGGGGCCGGG - Intergenic
900227567 1:1540232-1540254 CCCCGCCCGCGCGCGCCGCCTGG - Intronic
900372125 1:2336752-2336774 ACCCAGGCGGGGGCGGCCCCAGG + Exonic
901069266 1:6509170-6509192 GCCCTCACGCGGGCTGCCCCTGG + Intronic
901084638 1:6603014-6603036 CCCCGCGCGGCGCCCGCCCCCGG + Intronic
901098569 1:6701913-6701935 CGCCGGGCGCGGACGGCTCCGGG - Exonic
901251715 1:7784314-7784336 GACTGCGCGAGGGCGGCCCCGGG + Intronic
901762520 1:11479948-11479970 CCGCGCGCGCGAGGGTCCCCAGG + Intronic
902323556 1:15684251-15684273 CCCCAGGCGCAGGCGGGCCCTGG + Intergenic
902813426 1:18902423-18902445 GCGCGCGCTCGGGCCGCCCCGGG + Intronic
903012876 1:20343414-20343436 CCCCTCCCGCGGACGGCCTCCGG + Intronic
903142157 1:21345277-21345299 CCGCGAGCCAGGGCGGCCCCGGG + Intronic
903233898 1:21937405-21937427 CCCCGCCCACGGACCGCCCCCGG + Intergenic
903349952 1:22711328-22711350 CCACGCGCGCTCGCCGCCCCCGG + Intronic
904252891 1:29237519-29237541 CCGCCCCCTCGGGCGGCCCCGGG - Intronic
904500075 1:30908390-30908412 CCCCGCGCGGGGGGCGGCCCCGG + Intronic
904563391 1:31413318-31413340 CGGCGCGCGCGGGCGGGCGCCGG - Intronic
904773317 1:32893102-32893124 CACCGAGCGCGGGCCGCCCTGGG + Intronic
904822936 1:33256793-33256815 CCCGAGGCGCAGGCGGCCCCGGG - Intronic
905037827 1:34929347-34929369 CCCGGGGCGTGGGCGGCGCCGGG + Intronic
905037980 1:34929781-34929803 CCCCGCCCCCGCGCGGACCCAGG + Intergenic
905037996 1:34929815-34929837 CGCCGCCCGCGGGCGGCCGCCGG + Intergenic
905308466 1:37034319-37034341 CCTCGCTCGCGGGCAGCCCGTGG - Intergenic
905734565 1:40316649-40316671 ACCCGCGCGCCCGCAGCCCCCGG + Intronic
905862741 1:41361833-41361855 CCCCTCCCGCGGGCCTCCCCGGG + Intergenic
906130710 1:43453712-43453734 CCCCGCGCGGGTGCGGGCCGCGG - Exonic
906140631 1:43531623-43531645 CCCGGCGCACGTGCGGTCCCGGG + Intronic
906403344 1:45521729-45521751 ACCCGAGCGCGGGCGGGCCCCGG + Exonic
906627141 1:47334262-47334284 CGCCGCGCGCCGGCGGCCCTCGG - Intronic
906640553 1:47438379-47438401 CCCCGCGCTCTGGCGTCCCGGGG + Exonic
907906117 1:58784582-58784604 CCCCGCGCGGTGGCGGCCGCCGG - Intergenic
908501022 1:64744633-64744655 TCCCGCGCTGGGGCGGCCCGGGG - Intergenic
908951692 1:69568725-69568747 CCCCGCCCCCGGCCGGCCTCTGG - Intronic
911078856 1:93908986-93909008 CCCCGCCCGAGGCCTGCCCCGGG + Intronic
912337633 1:108877205-108877227 TCCCGCGGGCGGGCGGGTCCCGG - Exonic
912716875 1:111989533-111989555 CCTCGCGCGCGCGGGGCGCCGGG - Intergenic
912927950 1:113929823-113929845 CCCCCCGCGCGAGCCGGCCCGGG - Exonic
916667052 1:166975788-166975810 TCCCGAGCGCGGGCGTCCCTGGG - Intronic
918629491 1:186699257-186699279 CACCGCGCCCGGCCGGGCCCAGG - Intergenic
919451332 1:197775592-197775614 CCCCGCGCCCGGGCGGCCAGAGG + Intronic
921389729 1:214606131-214606153 TCCCGCCAGCGGGCGTCCCCGGG + Intronic
922753816 1:228083141-228083163 GTCCACGCGCGGGCGGCCTCGGG - Exonic
922925409 1:229343088-229343110 CCACGCGCGCTCCCGGCCCCCGG + Intronic
923630945 1:235649428-235649450 ACCCGCGCGCGGGCTTCCCCGGG + Intronic
923744400 1:236686812-236686834 CACCACGCGCGGGCGGCCCGCGG - Intronic
924090105 1:240492923-240492945 CCCCGCGCGCGCCCGGCCGCTGG - Exonic
924172416 1:241356678-241356700 CCCCGCGCCGCGGCGGCCGCCGG + Intronic
1062890467 10:1056450-1056472 CCCTGAGCGCAGGCGGCCCCGGG + Intronic
1064981926 10:21174015-21174037 CCGAGAGCGCGGCCGGCCCCAGG - Intronic
1065140564 10:22714761-22714783 CCCTGTGCGCGGGCGACCTCCGG + Intergenic
1065390085 10:25174585-25174607 CGCCGCCCGCGGGCCGCCTCGGG + Intergenic
1067091318 10:43266964-43266986 CGCAGCGCGGGGGCGGCCGCGGG - Intergenic
1068560764 10:58512743-58512765 CGCGGCGGGCGGGCGGCCCCTGG - Intergenic
1069386168 10:67884912-67884934 CGCCGCACCCGGGCAGCCCCTGG - Exonic
1070162627 10:73874835-73874857 GCCCGCGCGGGGTCCGCCCCGGG - Intergenic
1070198009 10:74176721-74176743 CCCCGCGCGCGGGCGGCCCCTGG - Intronic
1070570725 10:77637963-77637985 CCCCGGGCGCGGGCGGCCCGCGG - Intronic
1072021826 10:91410250-91410272 GCGCGCGCGGGGGCGGCCTCGGG + Intergenic
1072710674 10:97713907-97713929 CCCCAGGCGCGTGCGGCCCGCGG + Exonic
1072994274 10:100229488-100229510 GGCCGGGCGCGGGCGGGCCCTGG - Exonic
1073460091 10:103661229-103661251 CCCCGGCTGCGGGCTGCCCCTGG - Intronic
1074086178 10:110210156-110210178 CCCCGCGCGGGGCGGGCCCGTGG + Intronic
1074130420 10:110568258-110568280 CCCGGCCCGGGGGCGGCCCTGGG + Intronic
1074829993 10:117241334-117241356 CCCTGCGCCCCGGCTGCCCCGGG - Intronic
1075206971 10:120456885-120456907 CCCCGCCAGTGGGCGGCCCCTGG - Intergenic
1075654621 10:124152865-124152887 CCCCGCGGAGGGCCGGCCCCTGG + Intergenic
1076035696 10:127196765-127196787 CCCCGCGCGCAGGCGGCAGCCGG - Intronic
1076821562 10:132942391-132942413 CCCCGCCCCGGGGAGGCCCCGGG - Intronic
1076992099 11:280708-280730 CCACGCGCGCCGCCGCCCCCGGG + Exonic
1077065668 11:640041-640063 CCCCGCGCCCGGCCTTCCCCGGG + Exonic
1077065706 11:640137-640159 CCCCGCGCCCGGCCTCCCCCCGG + Exonic
1077090859 11:777617-777639 CCGCGCGCCCGGGCGGTCGCAGG + Exonic
1077269140 11:1666855-1666877 CCCACCGCCCGGGAGGCCCCGGG + Intergenic
1077271407 11:1683859-1683881 CCCACCGCCCGGGAGGCCCCGGG - Intergenic
1077491509 11:2862939-2862961 CCCACCGCCCGGGCCGCCCCGGG - Intergenic
1078090741 11:8263096-8263118 CCCGGGGGGCGTGCGGCCCCGGG + Intronic
1078090746 11:8263112-8263134 CCCCGGGCGCGTGCAGCCCGGGG + Intronic
1079407061 11:20156629-20156651 CCCCGCCCCCGTGCGTCCCCCGG - Intronic
1080283593 11:30585375-30585397 CGGCGCGCGCGGGCGGCCCCGGG + Intronic
1080690799 11:34556034-34556056 CACCGTGCCCGGCCGGCCCCAGG + Intergenic
1081911888 11:46705110-46705132 CCCTGTGTGTGGGCGGCCCCTGG + Exonic
1083662705 11:64259159-64259181 CGCCGGGCGCAAGCGGCCCCTGG + Exonic
1084004801 11:66317087-66317109 GCCCGCCCGCAGGAGGCCCCAGG - Intergenic
1084310210 11:68312479-68312501 GCCCTCCCGCGGGCGCCCCCCGG - Intergenic
1089729507 11:120511630-120511652 CCCCGCGCACGGCCGGCCGGGGG - Intergenic
1089966161 11:122656247-122656269 CCGCGCGCGCGGCCGGCCCTCGG + Intronic
1091219359 11:133920903-133920925 CCCCGCGGGCTGGAGGGCCCCGG - Exonic
1091473820 12:753068-753090 GCCCGGGCGGTGGCGGCCCCGGG - Exonic
1091616394 12:2053716-2053738 CCCCTCGCGGACGCGGCCCCGGG - Intronic
1091740780 12:2959285-2959307 CGCCGCGCGCGGGCGGGCGAGGG - Intergenic
1092253422 12:6914097-6914119 GCCTGCCCGAGGGCGGCCCCCGG - Exonic
1092843285 12:12562768-12562790 CTCCGGGCTCGGGCGGCCGCGGG - Intergenic
1095949253 12:47773121-47773143 TTCCGGGCGCGGGCGGCCTCCGG + Intronic
1096260084 12:50085110-50085132 CCGCGTGAGCGGGCGCCCCCAGG - Exonic
1096271172 12:50167358-50167380 ACCCGCGGGGAGGCGGCCCCAGG + Exonic
1096495456 12:52037158-52037180 GACAGCGCGCGGGCGGCCGCGGG + Intronic
1096983627 12:55743152-55743174 GCCCGCGCGCCCGCCGCCCCCGG + Intergenic
1097155022 12:57006268-57006290 CCCCGCCCGCGCGCCGACCCCGG - Intronic
1098255381 12:68610848-68610870 CCCCGCCCGCGGGCGGAAGCTGG + Exonic
1098595765 12:72272309-72272331 CCCTGCGCGCCTGCGGCTCCCGG - Intronic
1100260661 12:92929343-92929365 CCCCGCCCCCCGGCGGCCGCGGG - Intergenic
1100315473 12:93441485-93441507 TCCCGCGCGCCCGCGGCCTCCGG + Intronic
1100565494 12:95790473-95790495 CCCCGCGCGGTCCCGGCCCCTGG - Exonic
1101037193 12:100717342-100717364 CCCCGCGCGCCGGCAGCTCTAGG + Intergenic
1103400512 12:120640504-120640526 CCCCGCTTCCGGGCGGCCCCTGG - Intergenic
1105512299 13:21061135-21061157 CGCCGGGCGGGGGCGGCTCCGGG + Intronic
1105975500 13:25468882-25468904 GGCCGCGGGCGGGCGGCCACCGG - Intronic
1106304182 13:28495315-28495337 CCCCACGCGCGCTCGGCCCCGGG - Intergenic
1107058396 13:36130902-36130924 CGTTGCGTGCGGGCGGCCCCGGG - Intronic
1112506339 13:99978560-99978582 GCCCGGCCGCGCGCGGCCCCTGG + Intergenic
1113517757 13:110915693-110915715 CCCACCGCGCCGGAGGCCCCGGG - Intergenic
1113541958 13:111115764-111115786 TCCCGAGCGCGGCCGGCCTCAGG - Intronic
1113831261 13:113297426-113297448 CCTCGCGCCATGGCGGCCCCCGG + Exonic
1114224193 14:20723437-20723459 CCCCGCGCGGGGGAGGCTGCGGG + Intergenic
1114628828 14:24146790-24146812 CCCCTCCCTCGGGCAGCCCCTGG - Exonic
1114736705 14:25049946-25049968 CCCCGCGCGGGGCAGCCCCCCGG - Exonic
1116849366 14:49893123-49893145 CCCCGAGCGCGGGCTCCCTCCGG - Exonic
1117819195 14:59630713-59630735 CCATGCGCGCAGGCGGCTCCGGG - Intronic
1118808928 14:69260060-69260082 CCCCGAGCGCGCGCGTCCCCCGG - Exonic
1119383019 14:74240504-74240526 CCCCGAGCCCGCGCGTCCCCGGG - Intronic
1119601923 14:75982353-75982375 CCTGGCCCGCGGGCGGCCCCGGG - Intronic
1122131023 14:99604520-99604542 CCCCGCCCGCGGCCGGCTCCCGG + Intergenic
1123021066 14:105398255-105398277 CTCCGCGCGCGCGGGGCCGCAGG - Intergenic
1123040326 14:105487710-105487732 CCCCGCGCCCGCGCGCCCCGAGG + Intronic
1123041146 14:105490694-105490716 ACCCCAGCGCGGCCGGCCCCTGG - Intronic
1123630713 15:22258136-22258158 CCCCGCGCGCGCCCGCCCGCCGG + Intergenic
1123739943 15:23226442-23226464 TCCCGCCAGCGGGCGTCCCCGGG + Intergenic
1124215639 15:27805605-27805627 CACCGCTCGCAGGCGGACCCTGG - Intronic
1124291167 15:28455410-28455432 TCCCGCCAGCGGGCGTCCCCGGG + Intergenic
1124957328 15:34367687-34367709 CCCCGCGCGATGGCGCCCCACGG - Intergenic
1125834253 15:42736476-42736498 CCACGCTCGCGGGCCGGCCCCGG + Exonic
1127414943 15:58749225-58749247 CCCACCGCCCTGGCGGCCCCGGG - Intronic
1127547653 15:60005372-60005394 CTCAGCGCGCTGGCGGCCTCGGG + Exonic
1127789932 15:62390613-62390635 CCCAGCGCGCGGGGGGACGCGGG + Intronic
1128454130 15:67823244-67823266 GCCCGCGGGCGGGCGGACCCGGG + Intronic
1128704685 15:69830269-69830291 CCCCGCAGGAGGGCAGCCCCTGG - Intergenic
1128987348 15:72231027-72231049 CCCGGCGCGCCGGCCGGCCCCGG - Exonic
1129116625 15:73368485-73368507 CCCCGCGCCCAGCCGGGCCCGGG - Exonic
1129162240 15:73753219-73753241 GCCCGCGCCCCGGCCGCCCCCGG + Intergenic
1129862395 15:78872789-78872811 CCCTGCGCCCGCGCCGCCCCAGG - Intronic
1129933692 15:79432180-79432202 GCCCGCGCTCCAGCGGCCCCGGG - Intergenic
1130086354 15:80780724-80780746 CCCCGCCCTCGGGCGCGCCCTGG - Intronic
1130411835 15:83654222-83654244 CGCCGAGCCCGCGCGGCCCCGGG + Exonic
1131144369 15:90001746-90001768 GCCTGCGCGCGGCCGTCCCCAGG - Intronic
1131174402 15:90201163-90201185 CCCAGCGCTCCGGCGGCCGCCGG + Intronic
1131692846 15:94845189-94845211 CGACACGCGCGGCCGGCCCCGGG + Intergenic
1132586007 16:705975-705997 CCCCGCGCGCGGCGCGCTCCCGG + Intronic
1132778868 16:1612314-1612336 CCCCGCGCGCCCGCGCACCCCGG + Exonic
1132828931 16:1918270-1918292 CCCTGCGCCCTGGCCGCCCCCGG + Exonic
1132851525 16:2026971-2026993 CCCTGCCCGCGGGCGGCCGGTGG + Exonic
1132875627 16:2135722-2135744 CTCCGCGCGCGGGCGGGCCTGGG - Exonic
1132947126 16:2537942-2537964 CCCCGCCCCCGCGCGGCGCCGGG - Exonic
1133188318 16:4115953-4115975 GGCGGCGCGCGGCCGGCCCCGGG + Exonic
1134519359 16:14911631-14911653 CTCCGCGCGCGGGCGGGCCTGGG + Intronic
1134554574 16:15154597-15154619 CTCCGCGCGCGGGCGGGCCTGGG - Intergenic
1134707029 16:16310286-16310308 CTCCGCGCGCGGGCGGGCCTGGG + Intergenic
1134960511 16:18401838-18401860 CTCCGCGCGCGGGCGGGCCTGGG - Intergenic
1136399873 16:30011443-30011465 CCGCGCGCGCGGGCGGGGGCGGG - Intronic
1136491309 16:30610089-30610111 CCTCGGGCGCTGGCGGCCCCTGG + Exonic
1136627800 16:31472458-31472480 CCCCGCGCCCGGGCGCCCGCGGG - Intronic
1137261154 16:46831054-46831076 CCGCCCGCGCGCCCGGCCCCCGG + Intronic
1137555043 16:49465121-49465143 CCCCGCGCTCAGGCTGCCCCGGG - Intergenic
1137614562 16:49838913-49838935 CGGCCCGCGGGGGCGGCCCCGGG - Intronic
1137696941 16:50468076-50468098 CCCCTCCCGCTGGCGGCCGCTGG + Intergenic
1140462248 16:75148961-75148983 TCCCGCGCGCGCGCGCCCGCCGG - Intronic
1141069396 16:80939590-80939612 CACCGCGCCCAGCCGGCCCCTGG + Intergenic
1141906931 16:87033104-87033126 GCCCACGCCAGGGCGGCCCCGGG + Intergenic
1141972338 16:87492443-87492465 CCCCGCGCGCGCCCGCCCGCCGG - Intergenic
1141972369 16:87492513-87492535 CCCCGTGAGCGGGGGGCCCGAGG - Intergenic
1142299251 16:89247214-89247236 CCCCGCTCGGGGGCGGCCCCTGG - Intergenic
1142429594 16:90019137-90019159 CCCCGCGCGGGGACCGCGCCCGG + Intronic
1142509750 17:386045-386067 CCCCGGGCGGGGGCGGTTCCGGG - Intronic
1142638283 17:1270971-1270993 CCCCGCGCGCGGCCGGGCCGTGG - Exonic
1142760921 17:2041597-2041619 TCCCCCGCGCGGGCCGGCCCGGG - Exonic
1142836928 17:2594047-2594069 CACCGCGCCCGGGCGGCTGCAGG + Intronic
1143496430 17:7315249-7315271 CACCGCGCGCGGGCGGCGCCGGG + Intronic
1143749949 17:9021148-9021170 CCCCGCCCGCGCGCTCCCCCGGG + Intergenic
1144756082 17:17681531-17681553 CCGCGGGCGGGGGCGGCGCCCGG - Exonic
1144781121 17:17809194-17809216 CACGGCGCGGGTGCGGCCCCTGG - Intronic
1146581200 17:34040124-34040146 CCCCGGGCCCGGGCGGCCACGGG + Intronic
1147110366 17:38257154-38257176 CACCGAGCGCGGGCGACCGCCGG + Intergenic
1147139700 17:38454113-38454135 CCGCGCGCCCGGGCCGCGCCGGG + Intronic
1147192756 17:38747414-38747436 CCCAGCGCCCGGGCTTCCCCAGG + Intronic
1147210315 17:38869554-38869576 CCCTGCGCGCTGCCGGGCCCGGG - Intergenic
1148337432 17:46851341-46851363 CCCCGGGCGGGCGCGGCGCCAGG + Intronic
1148419144 17:47531277-47531299 CACCGAGCGCGGGCGACCGCCGG - Exonic
1148782447 17:50129618-50129640 CCCCGGCCGCGGGGGGCTCCGGG + Exonic
1148852452 17:50561542-50561564 CCCCGGCCCCGGCCGGCCCCCGG - Exonic
1150108565 17:62479022-62479044 GCCCGGGCCCGGGCGGCCGCGGG - Exonic
1150764739 17:67993932-67993954 CTCCGCGCTCGGGCAGCCGCGGG + Intergenic
1151565202 17:74893700-74893722 CCCCGGGGGCGGGTGTCCCCAGG - Intronic
1152222164 17:79074887-79074909 CGCGGCGCGGGGGCGGGCCCGGG + Intergenic
1152349893 17:79778514-79778536 CTCTGCCCGCGGGCGCCCCCAGG - Intronic
1152808740 17:82371418-82371440 ACCTGCGCGCGGGCGGGTCCAGG + Intergenic
1152834518 17:82520386-82520408 CCCCGCTCGTGGGTGGTCCCGGG - Intronic
1153565609 18:6414727-6414749 CCCCGCGCGGCGGCGGCCGTGGG + Intronic
1154304164 18:13218321-13218343 CCCCGCCCGCGGGCCAGCCCCGG - Intronic
1154304276 18:13218685-13218707 CAACGCGCGCGGGGGGACCCGGG - Intronic
1155055319 18:22177143-22177165 CCTGGCTCGCGGCCGGCCCCGGG + Intronic
1155257968 18:24014795-24014817 CCCCGCGCGCGCCCGGAGCCCGG - Exonic
1155654692 18:28178472-28178494 CCCCGCCCGCAGGTGGCTCCCGG - Intergenic
1156448496 18:37253740-37253762 CCCCGCGCCCCGGCCGCCCCCGG + Intronic
1159040325 18:63318527-63318549 CCCGGTGCGGGGGCGGCCCCCGG + Exonic
1160053125 18:75455531-75455553 CCCGGCGCAGAGGCGGCCCCGGG - Intergenic
1160453547 18:78980491-78980513 CCCCGCGCCAGGCCGGCCGCGGG + Intronic
1160500706 18:79400118-79400140 CCTCGCGCGCGCGCGACCGCAGG - Intronic
1160631247 18:80247522-80247544 CTCCTCCCGCGCGCGGCCCCTGG - Exonic
1160725696 19:616929-616951 CCCCGTCCGCGCGCGTCCCCCGG + Exonic
1160824142 19:1071559-1071581 CTCCGCGCGCGGCCGGCGCACGG - Intronic
1160847850 19:1174178-1174200 CTCCGCGCCCGGCCGGACCCGGG - Exonic
1160863641 19:1248218-1248240 CCCCCCACGCGGGCGCCCCCAGG + Intergenic
1160873227 19:1286317-1286339 GGCCGCGCGCGGGGGGCGCCCGG + Intronic
1160873259 19:1286399-1286421 CCCCACGCGCGCGCCGCCGCCGG + Intronic
1160937813 19:1605475-1605497 CCCCGCGCGCGTGCGCGCCGCGG - Exonic
1160980907 19:1816184-1816206 CCCTGCGCAGGGACGGCCCCAGG + Intronic
1161150104 19:2702870-2702892 CTCCGGGCGCGGGCGGGGCCGGG + Intergenic
1161203698 19:3029371-3029393 CCCCGCGCCCGCGCCCCCCCCGG + Intronic
1161550652 19:4910321-4910343 CCCCGCGCGCGTGCGCGACCGGG - Intronic
1162445132 19:10718225-10718247 CCCATGGCGCCGGCGGCCCCCGG - Exonic
1163154523 19:15432606-15432628 CCCCGCGGGCGCGCGCTCCCGGG + Intronic
1163154528 19:15432624-15432646 GGCCGCGCGCGGGGGGCGCCCGG - Intronic
1163398112 19:17075841-17075863 CGCCGCGCGCCGCCGGTCCCGGG - Exonic
1163715183 19:18869127-18869149 CCGCGCGCACTGGCGGCCCCAGG + Exonic
1165787976 19:38473681-38473703 CCCCGCCTGCGGGGTGCCCCCGG - Exonic
1166222841 19:41376714-41376736 CCCCGCGCGCAGCGGGCCCGGGG + Exonic
1166807586 19:45496631-45496653 CCCCGCGCTCTGGCGGCGACGGG - Intronic
1167048821 19:47066879-47066901 CCCCGCGTGCTGGCGGCCGGTGG - Exonic
1167643782 19:50695248-50695270 CCCCGCGCCCCCGCGCCCCCCGG - Intronic
1168159810 19:54502845-54502867 CCCCACGGGCAGGAGGCCCCCGG + Exonic
1168323812 19:55526560-55526582 CGCCGCGGGCGGGCGCCGCCTGG - Intergenic
1168344267 19:55642727-55642749 CCTCGCGCTGGGGCGGGCCCCGG - Exonic
1168408047 19:56120934-56120956 ACGCGCGCCCGGGCGGCCCGCGG - Intronic
924987932 2:288256-288278 CCCCGGCCGCGGGCGGACCTCGG + Exonic
925959739 2:9003707-9003729 CTCCGACCGCGGGCGGCCCAGGG - Exonic
926077383 2:9951942-9951964 CCGCGCGGGCGGGCGGGCGCGGG + Intronic
927787315 2:25982617-25982639 CCCCGCACCCGGGCCGCTCCGGG - Intronic
929033705 2:37671800-37671822 CCGCGCGCGCGCCCGGCCACCGG - Exonic
931671642 2:64653565-64653587 CCGCGGGCGCGGGGGGCTCCGGG - Intronic
931882432 2:66581625-66581647 CCCCGCGGGCTGGGGGCCCTGGG + Intergenic
932812284 2:74835074-74835096 CCGCGAGCGCGGACGGCCCCCGG - Intronic
933667094 2:84971970-84971992 CCCCGCCTGCGGGCGACCGCGGG + Intronic
933886310 2:86721137-86721159 CCCCGCTCCCAGCCGGCCCCGGG + Intronic
933923869 2:87075569-87075591 CCCCGCCCCCAGCCGGCCCCGGG - Intergenic
934522030 2:95025683-95025705 ACCCGCGCGCGGGGGCGCCCAGG + Exonic
934566986 2:95346618-95346640 CCCCGCGCCCCGGCGCCCGCGGG + Intronic
935250137 2:101253426-101253448 CGCCGCGGGCGGGCGGCGCGGGG - Exonic
935396955 2:102619510-102619532 CCCCGCCCGCGGGCCGCCCTGGG + Intergenic
935815524 2:106843185-106843207 CCGCGCGCGCGTGCGGACGCTGG - Exonic
935971508 2:108534417-108534439 GCCCCCGCGCGGCCGGCCCCTGG + Intronic
935991149 2:108719943-108719965 GCCCGGGCCAGGGCGGCCCCAGG - Intronic
936433242 2:112482173-112482195 CGCCGCGCCCGGGCGCCCGCCGG - Exonic
937065085 2:119011655-119011677 CCGCGCTCGCGGGCGGCTCTGGG + Intergenic
946395522 2:219442091-219442113 CTCCGGGGGCGGGCGGCGCCGGG + Intronic
946622460 2:221573617-221573639 CCCGGCGGCCGGGCGGCCGCTGG + Intronic
947846947 2:233252029-233252051 CCATGCGTGCGGGCGGCGCCAGG - Intronic
947992248 2:234497001-234497023 CCCGGAGCGCGGGCTTCCCCGGG + Exonic
948393476 2:237628040-237628062 CCTCGCGCGCTGGCGGCGCCCGG - Intronic
948449681 2:238061227-238061249 CCCCACGCGAGAGCGGCCACAGG - Intronic
948468549 2:238163625-238163647 CCCTGCGCCCGGCAGGCCCCTGG + Intronic
948479335 2:238240235-238240257 ACCCCCGCGGGGGCGGCACCGGG + Intronic
1169048663 20:2558552-2558574 CCCCGGGCTTGGGCTGCCCCCGG - Exonic
1169557809 20:6768414-6768436 CCCCGCGCGGGGCCGGCTCCGGG - Exonic
1170156616 20:13274671-13274693 CCCCCCCCGCGCCCGGCCCCCGG + Intronic
1170890177 20:20369234-20369256 TCCGGCGCGCGGGCGGCGGCGGG - Exonic
1170999273 20:21396833-21396855 CCGCGCGCCCGCTCGGCCCCAGG + Intronic
1172100597 20:32482647-32482669 CCGCGGGCGTTGGCGGCCCCTGG - Intronic
1172702723 20:36863033-36863055 ACCCGAGCGCGGACGGCCCTTGG + Exonic
1172764828 20:37345926-37345948 CCCCCAGCTCGGGCCGCCCCTGG + Intronic
1173243356 20:41317336-41317358 CCCCTCCCGCCGGCTGCCCCTGG - Intronic
1173488512 20:43458663-43458685 CCCCGCGCTCCGGCGTCCCATGG - Intronic
1174053781 20:47785028-47785050 CACCGAGCACAGGCGGCCCCGGG - Intronic
1174611165 20:51800330-51800352 GCTTGCGCGCGGGCGCCCCCTGG - Intronic
1175215905 20:57391607-57391629 CCCCGAGCGCGGGCTTCCCGCGG + Exonic
1175333485 20:58179994-58180016 CCCCGCGCGTGGGTGGCCCCCGG + Intergenic
1175856132 20:62122068-62122090 GCACGCGCGCGGGCGGGGCCTGG + Intergenic
1175911823 20:62408634-62408656 CCCCGCTCACGGGAGCCCCCAGG - Intergenic
1175998329 20:62821195-62821217 CCCCCAGCCCGGGCGGCCCCGGG - Exonic
1176232274 20:64038563-64038585 CCCCGCGCCCGGCCCGGCCCGGG - Intronic
1178673831 21:34614660-34614682 CCCCGCGCGCGGCCGGGACTGGG + Intronic
1178707863 21:34889642-34889664 CCGTGCGCTCGAGCGGCCCCAGG + Intronic
1179445389 21:41426873-41426895 CCACGCGCCGGGGAGGCCCCAGG - Intronic
1179991702 21:44951664-44951686 CAGCGCGCTCGGGCGGCTCCGGG - Intronic
1180215915 21:46323831-46323853 GGTCCCGCGCGGGCGGCCCCTGG - Exonic
1180737006 22:18024598-18024620 CAACGCGAGCGGGCGCCCCCAGG + Intergenic
1181006626 22:20016644-20016666 CCCCGCGCGCCAACGGACCCGGG - Exonic
1181160460 22:20957118-20957140 GCCCGCGCCCGGGCAGACCCGGG - Intergenic
1182532134 22:30968880-30968902 CGCGGCGCGCGGGCGGCGCGCGG - Intergenic
1183393734 22:37560377-37560399 TCCCGCCCGCGGGCGGGGCCCGG - Intergenic
1183702126 22:39456940-39456962 GCCCCCGCGCAGGCCGCCCCGGG + Intergenic
1184035233 22:41914937-41914959 CCTCGCCTGCGCGCGGCCCCCGG + Intergenic
1184680760 22:46071245-46071267 CCCCGCGGGCACGCCGCCCCGGG - Intronic
1185336004 22:50271117-50271139 CCCCGCGGGCGGGCAGGCGCGGG + Intergenic
1185387817 22:50544373-50544395 CAGCGCGCGCGAGCGCCCCCGGG - Intergenic
950345326 3:12287854-12287876 CCCGGCGCGGGGGCGGGCGCGGG - Intronic
950729827 3:14947765-14947787 CCCCGCGAGCCCGCGGCCCCCGG + Intronic
954540839 3:51392119-51392141 CGGCGGGCGCGGGCGGCCCTGGG - Exonic
955687582 3:61562154-61562176 CGCCGAGCGCGGGGGGCCCGTGG + Exonic
955916399 3:63912351-63912373 CCCCTCCCTCGGGCGGCCGCGGG + Intronic
956414597 3:69013321-69013343 CCCGGAGCGCAGGCGGGCCCCGG - Intronic
956659334 3:71583079-71583101 CCCCGCGCCCGGGCGGCCACCGG + Intronic
956837900 3:73110702-73110724 CCCCACGAGGAGGCGGCCCCGGG + Intergenic
960602171 3:119469171-119469193 TCCCCCGCGCGGCCGGCTCCCGG + Intronic
961779922 3:129315438-129315460 CCCCGGGCGCGGCCGGCTCCCGG - Exonic
962676954 3:137764581-137764603 CCCAGCGCCCAGGCAGCCCCGGG - Exonic
962751003 3:138434823-138434845 CCCAGGGCGCTGGGGGCCCCGGG - Exonic
963799043 3:149658522-149658544 CCCCGCGCCGGGGCGCACCCGGG - Intronic
966607393 3:181834848-181834870 CACCGCGCCCGGCGGGCCCCAGG + Intergenic
966696287 3:182793544-182793566 CGCCGGGCGGGGGCGGCGCCGGG + Exonic
966712008 3:182980693-182980715 CCCCGGGCGCGGGGGTCCCCCGG + Intronic
968008703 3:195259699-195259721 CCCAGCACCAGGGCGGCCCCCGG + Intronic
968187019 3:196639885-196639907 TCCCGCGTGGGGGCGTCCCCGGG + Intronic
969716882 4:8872028-8872050 AGCCGAGGGCGGGCGGCCCCGGG + Intergenic
971351862 4:25862759-25862781 CGCCGCTCGCGGTCGGCCCCCGG - Exonic
972418805 4:38867871-38867893 CCCCGCGCTCGCCCGCCCCCCGG - Intronic
973635936 4:52862191-52862213 CTCCGCGCGCGCGACGCCCCCGG - Intergenic
973931072 4:55793695-55793717 CCCCGGGCGGGCGCGGCCTCAGG + Intergenic
976813590 4:89122229-89122251 CACCGCGCCCGGCCAGCCCCTGG - Intergenic
978490089 4:109302873-109302895 CCCAGCCCGCGGGCCGGCCCGGG + Intergenic
981429844 4:144646008-144646030 CCCCGCGCGAGCGCGTCCCCCGG - Exonic
983229166 4:165112590-165112612 CCCCGCGCCCAGGCCTCCCCGGG + Intronic
984973584 4:185210424-185210446 GCCCGCGCGCGGCGGGCTCCGGG + Intronic
986184508 5:5423011-5423033 CCCCCCGCGCCCGGGGCCCCGGG - Intronic
986315420 5:6583410-6583432 ACCCGCGCGCTGTCGGCTCCGGG + Intergenic
987340549 5:16935907-16935929 CCCCGCGGGCGCGCGTCCTCGGG - Exonic
989147057 5:38259017-38259039 CCCCGAGCCCGGGCGGCGCTAGG + Intronic
989178729 5:38556246-38556268 CACCCCGCCCGGGCCGCCCCTGG + Intronic
991216805 5:64165669-64165691 AGCCGCGCGTGGGCGGCGCCGGG - Intergenic
991676610 5:69094468-69094490 CCCTGCGCGCAGGCTGCCTCCGG + Intronic
992269849 5:75053257-75053279 CCGCGCGCTCTGGTGGCCCCGGG + Intergenic
1001396067 5:171420229-171420251 CCCCGCGCGCGGGCGCTTACAGG - Exonic
1002186134 5:177455635-177455657 GCTGGGGCGCGGGCGGCCCCTGG + Intronic
1002291806 5:178205256-178205278 GGCAGCGCGCGAGCGGCCCCGGG - Intronic
1002487617 5:179550529-179550551 CCCAGCGGGCGGGCGGGCGCGGG - Intergenic
1002638389 5:180619197-180619219 CCCCGGGCGCGGGGCGCCGCGGG - Intronic
1003098159 6:3157803-3157825 CCACGGGCACGGGCGACCCCTGG + Intergenic
1003290787 6:4776653-4776675 CCCAGCGCCCGGCCGGCCGCGGG + Exonic
1003645477 6:7910426-7910448 CGCCGCGGGCGGGGGGTCCCGGG - Intronic
1004216962 6:13711865-13711887 CGCTGCGCGCGGGCGGCGCTAGG + Intergenic
1004228991 6:13814248-13814270 CCTCGCGCCCCGGCGGCCCGCGG - Exonic
1006458294 6:34144270-34144292 CCCCGCGCGGGGGCGGGGCCGGG - Intronic
1007320944 6:41028408-41028430 CCCCGAGCGCGGGGGCGCCCGGG - Exonic
1007701781 6:43770120-43770142 CCCCGCCCCCGGCCCGCCCCGGG - Intergenic
1011277042 6:85642264-85642286 CCCCGGGCGCCGACGACCCCCGG + Intronic
1013048896 6:106512697-106512719 CCCCGCCCGCCAGCGGCCCCCGG + Exonic
1013170745 6:107634733-107634755 GCCCGCGCCCGGGGGGCCCGGGG - Exonic
1014437487 6:121437078-121437100 CCCCGCGCCCGTCCGGCCCACGG - Intronic
1017174980 6:151494194-151494216 CCCCGCGCGCGGCCGGCGGCTGG - Intronic
1017174988 6:151494205-151494227 CCGCGCGCGGGGGTGGCCCTGGG + Intronic
1017324708 6:153131429-153131451 CCCCCTCCCCGGGCGGCCCCCGG + Intergenic
1017725822 6:157275193-157275215 CGCCGCCCGCGCCCGGCCCCGGG - Intergenic
1018400303 6:163414553-163414575 CCCCGCCCGCCGCCCGCCCCCGG + Intronic
1019551338 7:1604081-1604103 CCGGGCGAGCGGGCGGCCCGGGG - Intergenic
1019719426 7:2559296-2559318 CCCCGCGCAGGGGCCGGCCCGGG + Intronic
1019743683 7:2688172-2688194 CCCCGCGCGCCGACGTCACCGGG + Intronic
1020136892 7:5592708-5592730 CTCCGCGCGGGAGGGGCCCCGGG - Intergenic
1022396004 7:29989072-29989094 CGACGCGCGCGGGCCGCCCCTGG - Intronic
1023435124 7:40134457-40134479 CCCCGGGCGGGGGCGGACCACGG - Exonic
1023937294 7:44748949-44748971 CCCCTCGCCGTGGCGGCCCCCGG - Exonic
1023972279 7:45000213-45000235 CCCGGCTGGCGGGCGGCGCCGGG + Intronic
1024226936 7:47332523-47332545 CCCAGCCCGCGAGCTGCCCCAGG + Intronic
1026360307 7:69597586-69597608 CCCCGCGCCCGGATGACCCCTGG - Intergenic
1027002177 7:74661152-74661174 CACCGCGCCTGGGCGTCCCCGGG + Intronic
1028417453 7:90595917-90595939 TCCCGCGCGCGGGCGGGGCGGGG + Intronic
1029372521 7:100158534-100158556 CCCCGCCGGCGGTCGGCCTCCGG - Exonic
1029456628 7:100675207-100675229 AGGCGCGGGCGGGCGGCCCCAGG - Intronic
1031895974 7:127347989-127348011 CCCTGCGCCCGGCCGCCCCCGGG - Intronic
1032074566 7:128830335-128830357 CCCGCCGCGCCCGCGGCCCCCGG - Intergenic
1032119326 7:129144993-129145015 CCCCGGGCGCCGGCCGCCTCCGG + Exonic
1033361399 7:140640911-140640933 CTCCGCGCGGGGCCGGGCCCTGG - Intronic
1033732826 7:144195634-144195656 CCCCACCCGCGGCCCGCCCCTGG + Exonic
1033750225 7:144355383-144355405 CCCCACCCGCGGCCCGCCCCTGG - Exonic
1034147077 7:148883625-148883647 TCCCGCCCGCCGGCGGGCCCGGG + Intronic
1034339184 7:150341196-150341218 CCCGGCGCGGGGGCTGCCGCGGG + Exonic
1034617931 7:152435522-152435544 CTCCGCGCCCCGGCGCCCCCCGG - Intronic
1036910381 8:12754072-12754094 CCGCGCGGGCGCCCGGCCCCGGG - Intronic
1036910790 8:12755462-12755484 CCGCGCGCCCGGGAGGCTCCGGG - Exonic
1038017710 8:23529276-23529298 TCCCGCGCGCCGGCAGCCTCGGG + Intronic
1040512213 8:48105544-48105566 CCCCGCGAGGCGGCAGCCCCTGG - Intergenic
1040521428 8:48179288-48179310 CCCCTCCCACGGGCGGCACCTGG - Intergenic
1041244902 8:55880312-55880334 CCCCGCGCCCTGGCTCCCCCGGG - Intronic
1042246346 8:66712610-66712632 CTCCCCGCACGGGCTGCCCCCGG + Intronic
1047998611 8:130358714-130358736 CCCCGCCCGCGCCCCGCCCCCGG + Intronic
1047998638 8:130358759-130358781 CCCCGCTCGCGCACAGCCCCTGG + Intronic
1049212152 8:141391854-141391876 CCGGTCGCGCGGGCGGCCTCGGG - Intergenic
1049409035 8:142464274-142464296 CGCCGCGCGCGGGCGGCCGCCGG + Exonic
1049621105 8:143598667-143598689 CCCCGGGCGCAGGGGACCCCGGG + Exonic
1049663115 8:143829243-143829265 CCATGAGCGCGGGCGGCCCTCGG - Intronic
1049719265 8:144108128-144108150 CCCCGCGCGCCCGCGCCCGCCGG + Exonic
1050513043 9:6413972-6413994 CCCCGCCCTCTGGGGGCCCCAGG - Intronic
1051418757 9:16870569-16870591 CCCCGCGCCCGAGCGCCACCGGG - Intronic
1051896527 9:21994616-21994638 GCGCGCGCGCGGGCGGCTCAGGG + Intronic
1052982322 9:34458319-34458341 CCGCGCGGGGCGGCGGCCCCAGG + Exonic
1053312852 9:37030252-37030274 CCGCCCGAGCGGGCGGCCTCTGG + Intronic
1053408974 9:37903701-37903723 CCCCGGGCGCAGGCAGCTCCCGG + Exonic
1056532465 9:87498764-87498786 CCCCGCGCGCGCGTGGGGCCGGG - Intronic
1056746966 9:89311397-89311419 CCCCGCGGGCGGGGCGACCCAGG + Intronic
1057146971 9:92764946-92764968 CCCGGCGCCCGCCCGGCCCCCGG + Intergenic
1057337404 9:94166534-94166556 TCCAGCGGGCGGGTGGCCCCGGG + Intergenic
1057488634 9:95506108-95506130 CTCTGCGCGCCGGGGGCCCCGGG - Intronic
1057596230 9:96418045-96418067 CCCCCAGCTCCGGCGGCCCCGGG + Exonic
1057623253 9:96655191-96655213 CCCCGACAGCGGGCAGCCCCTGG - Exonic
1060700764 9:125747429-125747451 CGCCGCGCGCGGGCGGGAGCGGG - Exonic
1061264322 9:129496721-129496743 TGGCGGGCGCGGGCGGCCCCGGG - Intergenic
1061293604 9:129665849-129665871 CCATGCCCGCGAGCGGCCCCGGG - Exonic
1061490050 9:130939557-130939579 CCCCTTGCCCGGGCGGCCCGTGG + Intergenic
1061859368 9:133460253-133460275 CGCCCCGCCCCGGCGGCCCCAGG + Intronic
1061961691 9:133992045-133992067 CCCGGCGGGCGGGAGGGCCCCGG - Intronic
1061976004 9:134068225-134068247 CCCCGCCCCCGCGCGCCCCCCGG - Intronic
1062587298 9:137255160-137255182 GCCCGGGCGCGGGCGGGACCGGG + Exonic
1062596546 9:137302337-137302359 ACGCGCGCGCCGGCGGCCCCGGG + Intergenic
1185467667 X:364221-364243 CCCAGCGCGCCTCCGGCCCCAGG + Intronic
1189308602 X:40005395-40005417 CCCGGGGCGCGGGCGAGCCCTGG + Intergenic
1190008131 X:46759170-46759192 CCCCTCCCCCGCGCGGCCCCGGG - Intronic
1190567292 X:51743692-51743714 CCCCGCTCGGGGCCGACCCCGGG - Exonic
1190881550 X:54495681-54495703 CCCCGCGCGGGGCCGGGGCCGGG - Exonic
1192274748 X:69616927-69616949 TCGCGCGCGCCCGCGGCCCCTGG + Intronic
1196842542 X:119871809-119871831 CCCCGCTCGCGGGCGGCCGCGGG + Exonic
1198482317 X:137052427-137052449 CACCGCCCGCGGGCCACCCCTGG - Intergenic
1199793953 X:151177875-151177897 CCCTGCTCGCCGCCGGCCCCCGG - Intronic
1200163336 X:154020013-154020035 CCCCGCGCCGGGGAGGGCCCGGG + Intergenic
1200277740 X:154750731-154750753 CCCCGCGGGCAGGCGCCACCTGG + Intronic
1200787549 Y:7273750-7273772 CTCCGCGCCCGGGGCGCCCCCGG - Intergenic