ID: 1070199016 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 10:74185540-74185562 |
Sequence | GCAGAGTCGTCGGCCGGGCG CGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1070199012_1070199016 | 7 | Left | 1070199012 | 10:74185510-74185532 | CCAACAATATAATTTTTTTTTTT | 0: 1 1: 10 2: 94 3: 1201 4: 8134 |
||
Right | 1070199016 | 10:74185540-74185562 | GCAGAGTCGTCGGCCGGGCGCGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1070199016 | Original CRISPR | GCAGAGTCGTCGGCCGGGCG CGG | Intronic | ||
No off target data available for this crispr |