ID: 1070199016

View in Genome Browser
Species Human (GRCh38)
Location 10:74185540-74185562
Sequence GCAGAGTCGTCGGCCGGGCG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070199012_1070199016 7 Left 1070199012 10:74185510-74185532 CCAACAATATAATTTTTTTTTTT 0: 1
1: 10
2: 94
3: 1201
4: 8134
Right 1070199016 10:74185540-74185562 GCAGAGTCGTCGGCCGGGCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070199016 Original CRISPR GCAGAGTCGTCGGCCGGGCG CGG Intronic
No off target data available for this crispr