ID: 1070199472

View in Genome Browser
Species Human (GRCh38)
Location 10:74189755-74189777
Sequence TCTCCCTAACCTCTAACCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070199471_1070199472 -1 Left 1070199471 10:74189733-74189755 CCGTTAGCAGTTACTCTTCATGT 0: 1
1: 1
2: 18
3: 92
4: 528
Right 1070199472 10:74189755-74189777 TCTCCCTAACCTCTAACCCCTGG No data
1070199467_1070199472 18 Left 1070199467 10:74189714-74189736 CCAAAATGAAAACCCATACCCGT 0: 1
1: 1
2: 7
3: 161
4: 613
Right 1070199472 10:74189755-74189777 TCTCCCTAACCTCTAACCCCTGG No data
1070199470_1070199472 0 Left 1070199470 10:74189732-74189754 CCCGTTAGCAGTTACTCTTCATG 0: 1
1: 0
2: 5
3: 48
4: 321
Right 1070199472 10:74189755-74189777 TCTCCCTAACCTCTAACCCCTGG No data
1070199469_1070199472 5 Left 1070199469 10:74189727-74189749 CCATACCCGTTAGCAGTTACTCT 0: 1
1: 4
2: 32
3: 153
4: 495
Right 1070199472 10:74189755-74189777 TCTCCCTAACCTCTAACCCCTGG No data
1070199465_1070199472 20 Left 1070199465 10:74189712-74189734 CCCCAAAATGAAAACCCATACCC 0: 1
1: 5
2: 76
3: 296
4: 918
Right 1070199472 10:74189755-74189777 TCTCCCTAACCTCTAACCCCTGG No data
1070199466_1070199472 19 Left 1070199466 10:74189713-74189735 CCCAAAATGAAAACCCATACCCG 0: 1
1: 1
2: 7
3: 117
4: 547
Right 1070199472 10:74189755-74189777 TCTCCCTAACCTCTAACCCCTGG No data
1070199468_1070199472 6 Left 1070199468 10:74189726-74189748 CCCATACCCGTTAGCAGTTACTC 0: 2
1: 5
2: 95
3: 341
4: 765
Right 1070199472 10:74189755-74189777 TCTCCCTAACCTCTAACCCCTGG No data
1070199464_1070199472 21 Left 1070199464 10:74189711-74189733 CCCCCAAAATGAAAACCCATACC 0: 1
1: 2
2: 3
3: 59
4: 363
Right 1070199472 10:74189755-74189777 TCTCCCTAACCTCTAACCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070199472 Original CRISPR TCTCCCTAACCTCTAACCCC TGG Intronic
No off target data available for this crispr