ID: 1070207511

View in Genome Browser
Species Human (GRCh38)
Location 10:74278542-74278564
Sequence GATGATCAACTAGGAAAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 327
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 307}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070207511 Original CRISPR GATGATCAACTAGGAAAGAA AGG (reversed) Intronic
900040097 1:453505-453527 GATGACCAACTTGGATAAAATGG - Intergenic
900061528 1:688481-688503 GATGACCAACTTGGATAAAATGG - Intergenic
902294137 1:15454766-15454788 GATGGTTATCTAGGAAAGTAAGG + Intergenic
903984957 1:27220177-27220199 GATGATCAAGGGGAAAAGAAGGG - Intergenic
904641299 1:31932345-31932367 CAGGCTCAACTAGCAAAGAAAGG + Intronic
906353516 1:45083594-45083616 GTTGAACAACTGGGAAAGACAGG + Intronic
907148939 1:52263952-52263974 GGTGAGCAACTTGTAAAGAAAGG - Intronic
908201846 1:61805647-61805669 ATTGATCCACTAGGGAAGAAAGG - Intronic
908666899 1:66503208-66503230 GATGATAAACTGAGAAACAAAGG + Intergenic
908888460 1:68817060-68817082 GATGTTCAAGTAGCAAAGAATGG + Intergenic
909467712 1:75991797-75991819 GATGCTCATCCAGGAAGGAAAGG + Intergenic
910592768 1:88945167-88945189 GATGTTGAAAAAGGAAAGAAGGG + Intronic
913041775 1:115033763-115033785 CATGATCAACGATGAAAGAGAGG + Intronic
914926216 1:151890444-151890466 CATGATGAGCTATGAAAGAAAGG - Intronic
915673729 1:157511889-157511911 GCAGACAAACTAGGAAAGAAGGG - Intergenic
916268741 1:162918264-162918286 GCAGACAAACTAGGAAAGAAGGG + Intergenic
916705447 1:167344748-167344770 GATGATAGAGAAGGAAAGAATGG + Intronic
917220333 1:172721800-172721822 GCAGACAAACTAGGAAAGAAGGG + Intergenic
918805852 1:189043102-189043124 GATGATCATCTTGCAAAGTATGG - Intergenic
918960470 1:191269952-191269974 GATGATCAAATATGAAGGTAAGG + Intergenic
921570076 1:216767198-216767220 TATGAGTAACTAGGAAAGAAAGG - Intronic
921738679 1:218658152-218658174 GATGATCAACGATCAAAGAGAGG - Intergenic
921872980 1:220161186-220161208 GATGAGCACAGAGGAAAGAATGG + Intronic
921910303 1:220541458-220541480 GAAGATCAACAAGGAAACAGAGG - Intronic
922471141 1:225878046-225878068 GATAAACAACCAGGGAAGAAGGG + Intronic
923523328 1:234752919-234752941 GATGATCAGGTAGGAAAGAGGGG + Intergenic
924309263 1:242722862-242722884 CATGGTCACCAAGGAAAGAATGG - Intergenic
1063801240 10:9580836-9580858 GTTGATAAAATAGGAATGAAAGG + Intergenic
1065075019 10:22069455-22069477 GATGACCAACAAGGAAAGAGAGG - Intergenic
1065430071 10:25644960-25644982 GATGTACAACTATGAAAGCATGG - Intergenic
1067978279 10:51051496-51051518 GATTGGCAAATAGGAAAGAAGGG - Intronic
1068875353 10:61990152-61990174 GCAGCTCAACAAGGAAAGAAGGG - Intronic
1069281672 10:66662398-66662420 GATGGTCATCTAGGACAGTAGGG - Intronic
1069317542 10:67125879-67125901 GATGCTCAACTAGAAAAAACTGG + Intronic
1070207511 10:74278542-74278564 GATGATCAACTAGGAAAGAAAGG - Intronic
1070629161 10:78072209-78072231 TGTGATCAACTAGGAAAGGCTGG - Intergenic
1071312351 10:84354605-84354627 GATGTACAACAAGGAGAGAAAGG - Intronic
1071408708 10:85364640-85364662 GATTATGAACTAGGAACCAAGGG - Intergenic
1071420362 10:85490746-85490768 GAAGATCAACAAGGAAACAGAGG + Intergenic
1071604861 10:86978801-86978823 AAGGATAAACTAGGAAATAAAGG + Intronic
1071866040 10:89733035-89733057 GATGAACCACCAGCAAAGAAAGG + Exonic
1071953356 10:90729609-90729631 GATGACCAAAGAGAAAAGAATGG + Intergenic
1072795658 10:98352581-98352603 GAAGACAAACGAGGAAAGAAAGG - Intergenic
1072887613 10:99292999-99293021 GATTATCAACTGGGTAGGAAGGG - Intergenic
1073527689 10:104200294-104200316 GCAGATGAACTGGGAAAGAAGGG - Intronic
1075083046 10:119396716-119396738 GATGAAAAACTGGGAGAGAAAGG + Exonic
1076281065 10:129246701-129246723 TATGATCAGCTATGAATGAAGGG + Intergenic
1076341532 10:129750487-129750509 GTTCAACAACAAGGAAAGAATGG + Intronic
1076966320 11:89412-89434 GATGACCAACTTGGATAAAATGG - Intergenic
1077826377 11:5812742-5812764 GATAATCAACAAGGAAACACTGG + Intronic
1079650929 11:22928625-22928647 GATGATCTAGTAGGGGAGAAAGG - Intergenic
1080051079 11:27859786-27859808 GATGGTGAACAATGAAAGAAAGG + Intergenic
1080369684 11:31620529-31620551 GATGATCAACTTAAATAGAATGG + Intronic
1081436765 11:43035224-43035246 GATGATCCAGGAGGAAACAAGGG + Intergenic
1084163972 11:67366608-67366630 GATGTATAACTGGGAAAGAAGGG + Intronic
1085245213 11:75095621-75095643 AATCATCAAATAGGAATGAAGGG + Intergenic
1086287056 11:85262796-85262818 GCAGATGAACTGGGAAAGAAGGG - Intronic
1086724291 11:90163438-90163460 TGTCATCACCTAGGAAAGAAAGG - Intronic
1089242331 11:117092407-117092429 TATCATCATCTTGGAAAGAAAGG + Intronic
1089374934 11:117987515-117987537 GAGGATCAAGGAGGAGAGAAAGG + Intronic
1090000302 11:122950508-122950530 GATGAGAACCTAGGAATGAATGG - Intronic
1091825893 12:3512446-3512468 GATGAGCAAATTGGAAGGAAAGG - Intronic
1094444975 12:30519648-30519670 GCAGACAAACTAGGAAAGAAGGG - Intergenic
1095183137 12:39169833-39169855 GATTATCAATTTGGCAAGAAAGG - Intergenic
1096885276 12:54712586-54712608 GATAACCAACCAGGAAAAAAAGG - Intergenic
1097868139 12:64577079-64577101 AATGATAAACTAAGAAAGAAGGG + Intergenic
1097879110 12:64671170-64671192 GATGAGGGACCAGGAAAGAAAGG + Intronic
1097957270 12:65498982-65499004 GATGCTCAATTAGAAAATAAAGG + Intergenic
1097970480 12:65627925-65627947 GATGCTCATCTATGAAATAAAGG - Intergenic
1098355239 12:69606262-69606284 GACGGTCCACAAGGAAAGAAAGG + Intergenic
1098554890 12:71807443-71807465 AATGACCATCAAGGAAAGAATGG - Intergenic
1098624527 12:72646924-72646946 GAAGATCAATAAGGAAAGAGAGG + Intronic
1106939090 13:34756708-34756730 GAAGATCAACAAGGAAATAGAGG + Intergenic
1107072535 13:36286631-36286653 GATGATGAAGTTGGAAAAAAGGG - Intronic
1107094389 13:36518909-36518931 GGTGCTTAACAAGGAAAGAAAGG + Intergenic
1108094339 13:46884738-46884760 GATGATTAAATTAGAAAGAATGG - Intronic
1109061379 13:57625116-57625138 GCTGACAAATTAGGAAAGAATGG + Intergenic
1109665218 13:65525946-65525968 GATGTTTAACTAGGTGAGAAAGG + Intergenic
1113327598 13:109297146-109297168 GATGAACAGCAATGAAAGAATGG - Intergenic
1115605498 14:34997779-34997801 TATGAGGAACTAGGAAAAAAAGG - Intronic
1116394702 14:44433460-44433482 GCAGATGAACTGGGAAAGAAGGG - Intergenic
1116423490 14:44761811-44761833 GATGGACAACATGGAAAGAAAGG - Intergenic
1116927337 14:50653358-50653380 GCTGTTCATATAGGAAAGAAGGG - Intronic
1119887660 14:78156711-78156733 GCTTAACAATTAGGAAAGAAAGG - Intergenic
1121670013 14:95701924-95701946 GCAGATAATCTAGGAAAGAAGGG - Intergenic
1123975028 15:25545283-25545305 AATGATTCACCAGGAAAGAAAGG + Intergenic
1125354824 15:38805879-38805901 GATGAGCAATTAGAAAACAAAGG + Intergenic
1126285290 15:47003358-47003380 GCAGAAAAACTAGGAAAGAAGGG + Intergenic
1126378763 15:48024037-48024059 GATAATAATCTAGGAAAGAGAGG + Intergenic
1126521312 15:49597761-49597783 TAAGCTCAATTAGGAAAGAAAGG + Intronic
1126898259 15:53283469-53283491 GATGATTAATTATGAAAGCATGG + Intergenic
1126908154 15:53389566-53389588 GATGAGCCACTAAGCAAGAAAGG - Intergenic
1130246668 15:82257324-82257346 GATGATCAAGAAGAAAAGAGAGG - Intronic
1130453993 15:84086016-84086038 GATGATCAAGAAGAAAAGAGAGG + Intergenic
1130458810 15:84142488-84142510 GAAAACCAACTAGGAGAGAAAGG - Intergenic
1130577697 15:85106977-85106999 GCTGGTCACCTAGGAAAGACAGG + Intronic
1130997182 15:88910440-88910462 GATGATCATCCAGGAAACACTGG + Intronic
1131762580 15:95640521-95640543 GAGAATCCACTAGGGAAGAAAGG - Intergenic
1131992628 15:98105623-98105645 GAAGGTCAACTTGGAAGGAATGG + Intergenic
1132098302 15:99004851-99004873 GAAGGTCAACTTGGAAGGAATGG - Intronic
1133404986 16:5516413-5516435 GATCAACAACAAGGAAGGAATGG - Intergenic
1134383926 16:13754238-13754260 GAGAATCAGCTAGCAAAGAATGG + Intergenic
1135610468 16:23862023-23862045 GCTAATCAACCAGGAAAAAAGGG - Intronic
1136182333 16:28562253-28562275 GATGATCAACTATCTAAGAAAGG - Intronic
1136904515 16:34074988-34075010 AATCATCAACTAGAATAGAATGG + Intergenic
1138034502 16:53590789-53590811 GATGATCAACTTGGTAATACAGG - Intergenic
1138211311 16:55165418-55165440 GATGCTCAATTAGAAAAGGATGG - Intergenic
1140404467 16:74699479-74699501 TATGATCTACAAGGGAAGAAAGG + Intronic
1142333068 16:89468132-89468154 AATCATGAACTTGGAAAGAAGGG + Intronic
1144357919 17:14463295-14463317 GGTTATCAACTAGAAATGAAAGG + Intergenic
1144469852 17:15528927-15528949 GATGATTAACTAGGAAAAAGAGG - Intronic
1144615105 17:16763111-16763133 AATGATCAACTAGGGTTGAAGGG + Intronic
1144897598 17:18552547-18552569 AATGATCAACTAGGGTTGAAGGG - Intergenic
1145134774 17:20393168-20393190 AATGATCAACTAGGGTTGAAGGG + Intergenic
1145377956 17:22369038-22369060 GCAGATCAGCAAGGAAAGAAAGG + Intergenic
1146664787 17:34692149-34692171 GTTGGACATCTAGGAAAGAATGG + Intergenic
1147133444 17:38421895-38421917 GAGGAGCAAAGAGGAAAGAAGGG - Intergenic
1148629350 17:49094595-49094617 CAAGATTAAATAGGAAAGAATGG - Intergenic
1153575801 18:6519795-6519817 GAAGATCAATGAGGAAATAAAGG - Intronic
1153763026 18:8349972-8349994 CATTATCAACTAAGACAGAAAGG + Intronic
1155195764 18:23472441-23472463 GATGTTAATCTGGGAAAGAAAGG - Intronic
1155484140 18:26323255-26323277 GATGATCAATAAGGAAACAGAGG - Intronic
1155975068 18:32119835-32119857 GATTATCAAACAGGAAAAAAAGG - Intronic
1156148982 18:34222274-34222296 GATGAACAACAAAGAAAGATGGG - Intronic
1158257362 18:55566974-55566996 GTAGATCTACTAGAAAAGAATGG + Intronic
1158959354 18:62575600-62575622 CATGATCAATAAGGAAAGGAAGG - Intronic
1159188317 18:65008290-65008312 TATGATCAAGAAAGAAAGAAGGG + Intergenic
1159476710 18:68930095-68930117 GAAGATCTACAAGGAAACAAAGG + Intronic
1160643124 19:159035-159057 GATGACCAACTTGGATAAAATGG - Intergenic
1161886578 19:7001132-7001154 GGTGGTCCACTTGGAAAGAATGG + Intergenic
1163181330 19:15606051-15606073 GCAGACAAACTAGGAAAGAAAGG + Intergenic
1163406247 19:17124903-17124925 GATCCACAAATAGGAAAGAACGG + Intronic
1164871638 19:31650389-31650411 GGTGATCAACCAGAAAAAAATGG - Intergenic
1165222128 19:34325126-34325148 GATGACCCAAGAGGAAAGAAAGG - Intronic
1165694245 19:37888506-37888528 GAAGAGAAACTAGCAAAGAAAGG - Exonic
925279766 2:2675353-2675375 CATCATCAAGTAGGAAACAAAGG + Intergenic
925446104 2:3928366-3928388 GATGAGCAAGTTGGGAAGAAAGG + Intergenic
925459704 2:4049952-4049974 GCAGACAAACTAGGAAAGAAGGG - Intergenic
928407663 2:31027098-31027120 GATGAGAAACTAGGAAACACAGG + Intronic
929249177 2:39733944-39733966 GATGATGAAATAGGAAAAAAGGG - Intergenic
929261400 2:39870428-39870450 GATGATAAATGAAGAAAGAATGG + Intergenic
930515349 2:52401082-52401104 CATGATGAACTAAGAAAGACTGG - Intergenic
930658421 2:54029927-54029949 GCAGACAAACTAGGAAAGAAGGG + Intronic
931241647 2:60459505-60459527 GATGATTAACTAGGACATAATGG + Exonic
931287981 2:60848760-60848782 GCAGACAAACTAGGAAAGAAGGG - Intergenic
931485199 2:62683721-62683743 GTGGAAAAACTAGGAAAGAAGGG + Intronic
933144562 2:78835808-78835830 GGTGATGAATTAGGTAAGAAAGG - Intergenic
933561647 2:83894673-83894695 AATGATCAAATAAGAAATAAGGG - Intergenic
934151093 2:89148291-89148313 GCAGAGAAACTAGGAAAGAAGGG - Intergenic
934192284 2:89810582-89810604 CATCATCAAATAGAAAAGAAAGG + Intergenic
936174630 2:110209091-110209113 GTTGATCTACTAGGAATGAAAGG + Intergenic
936371995 2:111909770-111909792 GCAGATGAACTGGGAAAGAAGGG - Intronic
937648916 2:124298333-124298355 GAAGATGAGCTGGGAAAGAAGGG + Intronic
940399557 2:153232070-153232092 GGTGCTCAACTTGAAAAGAAAGG - Intergenic
940455657 2:153895665-153895687 GATGGTCAAATAGGAAAGTTGGG + Intronic
940584683 2:155631333-155631355 GATCATCAATTAGGAAAGTCTGG - Intergenic
941621424 2:167783601-167783623 TAAGAGCAAATAGGAAAGAAGGG + Intergenic
942341020 2:174947212-174947234 GATGAGCCACTATGAAAAAAAGG + Intronic
942642661 2:178075835-178075857 GAGGTCCCACTAGGAAAGAATGG + Intronic
942840622 2:180356855-180356877 GAAGGTCAACAAAGAAAGAATGG - Intergenic
943308359 2:186295726-186295748 GACTATCAACCTGGAAAGAAAGG + Intergenic
944990221 2:205226910-205226932 GTGGATCAATTAAGAAAGAATGG - Intronic
945140876 2:206685096-206685118 GAAGGGCAACTATGAAAGAAGGG + Intronic
945179050 2:207073236-207073258 GACGATCAACTAGGCAAGCTTGG - Intergenic
945585953 2:211663063-211663085 TATGCTCAATTTGGAAAGAAGGG + Intronic
1171082921 20:22206493-22206515 TATAATCACCTAGGAAATAATGG - Intergenic
1171806561 20:29686166-29686188 GCAGATCAGCAAGGAAAGAAAGG + Intergenic
1171837487 20:30170314-30170336 GCAGATCAGCAAGGAAAGAAAGG - Intergenic
1171855833 20:30342174-30342196 GCAGATCAGCAAGGAAAGAAAGG - Intergenic
1172016260 20:31875474-31875496 GATCAGTAACTAGGAAAGAGTGG - Intronic
1174211316 20:48880742-48880764 GCTTATTTACTAGGAAAGAAGGG + Intergenic
1175532536 20:59684037-59684059 GATGAGAACCTTGGAAAGAAAGG + Intronic
1175650272 20:60715621-60715643 GATGCTCACCTATGAAGGAAGGG - Intergenic
1176422310 21:6526061-6526083 GCAGATGAACTAGGAGAGAAGGG - Intergenic
1179697801 21:43134377-43134399 GCAGATGAACTAGGAGAGAAGGG - Intergenic
1180573887 22:16754532-16754554 GCAGATCAACAAGGAAAGAAAGG - Intergenic
1180867968 22:19130269-19130291 GCAGACAAACTAGGAAAGAAGGG + Exonic
1182809151 22:33101222-33101244 TATGATCATCTAGTAAGGAACGG - Intergenic
1183006828 22:34910303-34910325 GATAATGACCTTGGAAAGAAAGG + Intergenic
1184813022 22:46850049-46850071 GATGCACACCCAGGAAAGAAGGG - Intronic
1202726228 2_KI270716v1_random:1198-1220 AATGATCAAATGGGATAGAACGG - Intergenic
949351467 3:3127904-3127926 GCAGATAAACTAGGAAAGAAAGG + Intronic
951824156 3:26848610-26848632 CATTTTCAAATAGGAAAGAAAGG + Intergenic
955230332 3:57093468-57093490 GATGCTCAACTCTGAAAAAAAGG + Exonic
955452772 3:59087726-59087748 GAGGATGAACTATGAAGGAATGG - Intergenic
956387685 3:68738154-68738176 GATGATTAGCCAGAAAAGAAAGG + Intronic
956488596 3:69747766-69747788 GATGATCCTAGAGGAAAGAAAGG - Intronic
956492059 3:69783370-69783392 GTTGAACAAATAGAAAAGAAAGG + Intronic
957170624 3:76732394-76732416 GAGGCTTAACTAGGGAAGAATGG + Intronic
957173388 3:76770385-76770407 TATGATCATCTAGAAAAAAAGGG - Intronic
957415682 3:79900362-79900384 GATGATCAAATAGCAAGGATGGG + Intergenic
957602131 3:82351037-82351059 GAAGATCAACAAAGAAACAATGG + Intergenic
958579184 3:95994301-95994323 GCTGATCAACAAGTAAGGAAGGG + Intergenic
958590052 3:96145312-96145334 GATCATCTAATGGGAAAGAAGGG - Intergenic
960052411 3:113251141-113251163 GATGACCAAGTAGGAAGGCACGG - Intronic
961849603 3:129802384-129802406 GATGGTGAACTAGGAAACATAGG + Intronic
963425627 3:145118924-145118946 GATGATAATGTTGGAAAGAAGGG - Intergenic
963658887 3:148098341-148098363 GATTAGCAACTAGGAAATAACGG - Intergenic
964748849 3:160036463-160036485 GATGCTCAACCAGCAAAGAGGGG + Intergenic
967342443 3:188414646-188414668 TATTCTCATCTAGGAAAGAAAGG - Intronic
967599725 3:191371162-191371184 GGTAATCAAATAGCAAAGAAAGG - Intronic
967623902 3:191664539-191664561 GGTCATCAAAAAGGAAAGAAAGG + Intergenic
968295390 3:197572515-197572537 GCAGATGAACTGGGAAAGAAGGG - Intronic
970969451 4:21964665-21964687 GAAAATCAAATAGGAATGAAGGG + Intergenic
973066112 4:45795363-45795385 GCAGACAAACTAGGAAAGAAGGG + Intergenic
973958897 4:56090172-56090194 CAGGATCAACTAGTTAAGAAAGG + Intergenic
975054907 4:69918153-69918175 GGTGATATACTTGGAAAGAAAGG - Intergenic
975225747 4:71870063-71870085 GCAGATGAACTGGGAAAGAAGGG + Intergenic
975886886 4:78976821-78976843 GATGATCAACAATGATAGACTGG - Intergenic
976393394 4:84529535-84529557 GGTTTTCAACTAGAAAAGAATGG + Intergenic
976460957 4:85312121-85312143 GAATATCAACAAGGAAACAACGG - Intergenic
976750578 4:88448178-88448200 GCAGACAAACTAGGAAAGAATGG - Intergenic
977278203 4:95005622-95005644 AAAGAAAAACTAGGAAAGAAAGG - Intronic
982121807 4:152150315-152150337 GATGTTCAACCGGTAAAGAAAGG + Intergenic
982125144 4:152177920-152177942 GAAGATGCACTGGGAAAGAAGGG - Intergenic
982246617 4:153359177-153359199 GATGAACAAGTAGGAAACAGCGG - Intronic
983524637 4:168748662-168748684 GAGGCTCAACTGGGGAAGAATGG + Intronic
983757681 4:171361630-171361652 GCAGATGAACTGGGAAAGAAGGG + Intergenic
984454616 4:179948725-179948747 GATTTTCTAATAGGAAAGAAAGG - Intergenic
985097686 4:186429130-186429152 GCAGACAAACTAGGAAAGAAGGG - Intronic
986269252 5:6217029-6217051 CAAGATCAACTTGGAAAGCAGGG + Intergenic
986596793 5:9430988-9431010 GCTGATTATGTAGGAAAGAAAGG + Intronic
988561186 5:32282935-32282957 TGTGATCAACAAGCAAAGAATGG - Intronic
988991274 5:36673161-36673183 GATGATCTAGTAGGAAGAAAGGG + Intronic
990827284 5:59915239-59915261 GATGACCAGCTAGGGCAGAATGG + Intronic
992391833 5:76336768-76336790 GATCATGAAGCAGGAAAGAAAGG - Intronic
993983908 5:94574238-94574260 GATCCACAACTAGTAAAGAAAGG + Intronic
996215300 5:120858681-120858703 GATGGTGAAATAGGAAATAAAGG + Intergenic
996319693 5:122200986-122201008 GATGTCCAGCTAAGAAAGAAAGG - Intergenic
996595345 5:125195281-125195303 GTTGATCAACTCAGGAAGAAAGG + Intergenic
996975202 5:129424398-129424420 GCTGATGAACTATGAAAGAGAGG - Intergenic
998361472 5:141591747-141591769 GATGATGCCCTAGGAAAGCAAGG - Intronic
998825605 5:146098309-146098331 GATGATTAACTTGGAAACAAAGG + Intronic
999337736 5:150737215-150737237 GATGGTCAACAAAGAAACAATGG + Intronic
1001461235 5:171916536-171916558 GATGAAGAACAAGGAAACAAAGG + Intronic
1001877430 5:175213501-175213523 GATGGTGAAGAAGGAAAGAAGGG - Intergenic
1002005711 5:176232628-176232650 GAAGAAGAACTAGGAAAGAGAGG + Intergenic
1002220668 5:177677996-177678018 GAGGAAGAACTAGGAAAGAGAGG - Intergenic
1002733750 5:181365438-181365460 GATGACCAACTTGGATAAAATGG + Intergenic
1002750793 6:108682-108704 GATGACCAACTTGGATAAAATGG - Intergenic
1002961981 6:1923845-1923867 GATGGACAGATAGGAAAGAAAGG + Intronic
1003387284 6:5680474-5680496 TATGATCAACTAGAAATAAAAGG + Intronic
1004587778 6:17019260-17019282 GATGCTCAACTGGGACAGAAAGG + Intergenic
1005178319 6:23073592-23073614 AATGATGAAGTAGGAATGAAAGG + Intergenic
1005356136 6:24985195-24985217 CATTATCAACTAGGATAGAAAGG + Intronic
1006178668 6:32139945-32139967 GCAGACAAACTAGGAAAGAAGGG + Intergenic
1006185889 6:32181523-32181545 GATGGTCAACAAGAAAGGAATGG - Intronic
1006477280 6:34264779-34264801 GATGATCAATAAGGAAACATAGG + Intergenic
1007244138 6:40447977-40447999 GATAATTAACCAAGAAAGAATGG + Intronic
1007439849 6:41849398-41849420 GAAGATCAACATGGAAAGAGAGG + Intronic
1008013635 6:46492927-46492949 GATGCTTTACTTGGAAAGAAAGG - Intergenic
1008937535 6:57007884-57007906 GCAGACAAACTAGGAAAGAAGGG + Intronic
1009294358 6:61926528-61926550 GATATTAAACAAGGAAAGAATGG + Intronic
1011657774 6:89566960-89566982 GCTCATGAATTAGGAAAGAAAGG - Exonic
1011744373 6:90395590-90395612 GATGAAAAACTAGAATAGAAAGG - Intergenic
1011933855 6:92749872-92749894 GACAATCAACTTGGAAAGAAAGG - Intergenic
1012145950 6:95681916-95681938 GCAGACAAACTAGGAAAGAAGGG + Intergenic
1012611054 6:101221218-101221240 AAAGGTCTACTAGGAAAGAAAGG - Intergenic
1014231916 6:118913483-118913505 GATGGTCAGATAGGAAAGGAAGG - Intronic
1014709330 6:124787890-124787912 GATTATCAAGCAGGAAAGATAGG - Intronic
1015118700 6:129677439-129677461 TATTATGAACAAGGAAAGAAGGG - Intronic
1016112960 6:140248723-140248745 GATGGGCAACAAAGAAAGAATGG + Intergenic
1017782525 6:157727201-157727223 GCAGACAAACTAGGAAAGAAGGG + Intronic
1019237998 6:170637758-170637780 GATGACCAACTTGGATAAAATGG + Intergenic
1021574820 7:22097331-22097353 GATGAGCTCCGAGGAAAGAAAGG + Intergenic
1022862209 7:34379190-34379212 CATGAACAACTGGTAAAGAAAGG - Intergenic
1023853781 7:44167383-44167405 GAAGATCAATAAGGAAAGAGAGG + Intronic
1023901737 7:44486648-44486670 GATGAGCAACTCTGAAAGCATGG - Intronic
1024007683 7:45239400-45239422 GCAGACAAACTAGGAAAGAAGGG - Intergenic
1025286000 7:57661557-57661579 GCAGATCAGCAAGGAAAGAAAGG - Intergenic
1025300164 7:57813206-57813228 GCAGATCAGCAAGGAAAGAAAGG + Intergenic
1029149445 7:98469775-98469797 CATAACCAACTTGGAAAGAAAGG + Intergenic
1032770567 7:135050424-135050446 GATGATCAATAAGGAAACAGAGG - Intronic
1035311744 7:157974170-157974192 GATGATCATTGTGGAAAGAATGG + Intronic
1035509771 8:168851-168873 GATGACCAACTTGGATAAAATGG - Intergenic
1037147424 8:15589901-15589923 GAGGATAGAGTAGGAAAGAACGG + Intronic
1037941869 8:22957617-22957639 GCAGATGAACTAGGAAAGGACGG + Intronic
1038039444 8:23711431-23711453 GTGTACCAACTAGGAAAGAAAGG - Intergenic
1038692781 8:29778288-29778310 TTTGATCAATTAGAAAAGAAAGG + Intergenic
1038803041 8:30766382-30766404 GCAGACCAACTAGGAAAGAAGGG + Exonic
1040800469 8:51333918-51333940 GAAAATCAACAAGGAAATAATGG + Intronic
1041682693 8:60609234-60609256 GAGGATCAAGTCGGAAGGAAGGG - Intronic
1041943645 8:63417537-63417559 GATGATAAAAGAGGACAGAAAGG - Intergenic
1042664204 8:71188668-71188690 GATCATCACCGGGGAAAGAATGG - Intergenic
1043009030 8:74858718-74858740 GATGATCTACTATGATAGACTGG + Intergenic
1043140057 8:76576574-76576596 CTTGATCAATTAGGAAAGCAGGG + Intergenic
1043262739 8:78222245-78222267 GATCATTAAATATGAAAGAAGGG + Intergenic
1044847278 8:96394554-96394576 GAAGATCAAAGAGAAAAGAATGG + Intergenic
1045113751 8:98959252-98959274 GATGATCTATTTGGAAAGATAGG - Intergenic
1046262675 8:111790229-111790251 ATTGATCATCTTGGAAAGAATGG + Intergenic
1046824495 8:118672455-118672477 GATCATTCACTAGGATAGAATGG + Intergenic
1047562706 8:126007118-126007140 GAGGAGGAAGTAGGAAAGAAAGG + Intergenic
1050147240 9:2582398-2582420 GATAATTAACAAGGAAAGACTGG + Intergenic
1050365787 9:4872684-4872706 GATGAACAGCTGTGAAAGAAGGG + Intronic
1051136278 9:13925387-13925409 GATCTTCAACGAGGAAAGGAGGG + Intergenic
1052242048 9:26284864-26284886 AATGATCAACAAGAAAACAAAGG - Intergenic
1055158793 9:73098185-73098207 GCAGACAAACTAGGAAAGAAGGG - Intergenic
1055710029 9:79050556-79050578 AATGATGAAATAAGAAAGAAGGG + Intergenic
1056472413 9:86918771-86918793 GATGATCAACTAAGGAAGTTGGG + Intergenic
1056956972 9:91090418-91090440 GATGATCAGCCAGGACAGAGGGG + Intergenic
1057090533 9:92254241-92254263 AGAGATCAAGTAGGAAAGAAAGG + Intronic
1057558131 9:96104180-96104202 AATGATCAACAAAGAAATAAAGG - Intergenic
1058005886 9:99913852-99913874 GATTTTCAACTGTGAAAGAAAGG + Intronic
1058605835 9:106721922-106721944 AATAATCAACTAGGAAATCAAGG - Intergenic
1060063532 9:120482731-120482753 GATGATTAAGTAGGTAAGAGGGG + Intronic
1060457489 9:123812382-123812404 GATCATCAACAGGGAAAAAATGG - Intronic
1062758204 9:138318054-138318076 GATGACCAACTTGGATAAAATGG + Intergenic
1186182293 X:6985107-6985129 GCAGATGAACTGGGAAAGAAGGG + Intergenic
1187010959 X:15278725-15278747 AACGATCAAAGAGGAAAGAACGG - Intergenic
1187543580 X:20224699-20224721 GATGATCAACTTGAAACAAATGG + Intronic
1187918174 X:24175405-24175427 GATGATCAAATGGGAATGTATGG - Intronic
1188187722 X:27135623-27135645 TATAATAAACTAGGAAAGGAAGG - Intergenic
1189073582 X:37890509-37890531 GCAGATGAACTAGGAGAGAAGGG - Intronic
1190571574 X:51787651-51787673 GAAGAAAAACTAGTAAAGAAAGG - Intergenic
1190579873 X:51881882-51881904 GAAGGTCAAGTAGGAAAGAAAGG - Intronic
1190802226 X:53801279-53801301 GAAGATCAATAGGGAAAGAAAGG + Intergenic
1192043469 X:67647014-67647036 GATGAGAAAATAGAAAAGAAAGG - Intronic
1192968770 X:76208304-76208326 GCAGACAAACTAGGAAAGAAGGG - Intergenic
1195476067 X:105287240-105287262 GAGCATTAACTAGGAAAGACAGG + Intronic
1195786069 X:108525031-108525053 GAAGATCAACAAGGAAATAGAGG - Intronic
1196623606 X:117852416-117852438 GATCATTAACTAGAAGAGAATGG + Intergenic
1196910928 X:120483549-120483571 GAAGAGAAACTTGGAAAGAATGG - Intergenic
1197388815 X:125835125-125835147 TATGATCAACTAGTAAACCAAGG + Intergenic
1197447820 X:126572937-126572959 GGTCATCAACAAGGAATGAAGGG - Intergenic
1197481383 X:126990992-126991014 GATTATCAATTAGGAAAAATGGG - Intergenic
1198146280 X:133860645-133860667 GCTGATCAGCTAGGAGAGAGTGG + Intronic
1199564649 X:149202213-149202235 GAAGATCAATTAGGAAATAGAGG - Intergenic