ID: 1070207803

View in Genome Browser
Species Human (GRCh38)
Location 10:74281331-74281353
Sequence ACTATCAAATCAATGGGAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 152}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070207803_1070207812 7 Left 1070207803 10:74281331-74281353 CCCTCTCCCATTGATTTGATAGT 0: 1
1: 0
2: 0
3: 8
4: 152
Right 1070207812 10:74281361-74281383 CTTGAGAGCCAGTTCATTGGGGG No data
1070207803_1070207811 6 Left 1070207803 10:74281331-74281353 CCCTCTCCCATTGATTTGATAGT 0: 1
1: 0
2: 0
3: 8
4: 152
Right 1070207811 10:74281360-74281382 CCTTGAGAGCCAGTTCATTGGGG No data
1070207803_1070207808 4 Left 1070207803 10:74281331-74281353 CCCTCTCCCATTGATTTGATAGT 0: 1
1: 0
2: 0
3: 8
4: 152
Right 1070207808 10:74281358-74281380 GGCCTTGAGAGCCAGTTCATTGG No data
1070207803_1070207814 26 Left 1070207803 10:74281331-74281353 CCCTCTCCCATTGATTTGATAGT 0: 1
1: 0
2: 0
3: 8
4: 152
Right 1070207814 10:74281380-74281402 GGGGAAGTTCCCCACTTTTTTGG No data
1070207803_1070207809 5 Left 1070207803 10:74281331-74281353 CCCTCTCCCATTGATTTGATAGT 0: 1
1: 0
2: 0
3: 8
4: 152
Right 1070207809 10:74281359-74281381 GCCTTGAGAGCCAGTTCATTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070207803 Original CRISPR ACTATCAAATCAATGGGAGA GGG (reversed) Intronic
900913924 1:5621179-5621201 AATGTCAAAGCAAGGGGAGAGGG + Intergenic
904601974 1:31678220-31678242 TCTATCAAATCATTGGGGCAAGG + Intronic
906863860 1:49394222-49394244 ACTAGAAAATCAATGGGGAAGGG - Intronic
910298170 1:85674155-85674177 ACTATCAAAGCAAAGGAAGGGGG - Intronic
911493846 1:98605190-98605212 ATTACCAACCCAATGGGAGATGG - Intergenic
919994390 1:202734789-202734811 ACAAAGAAATCAATGGGAGAAGG + Intronic
921948988 1:220909503-220909525 GCTCTCAACTCATTGGGAGAGGG - Intergenic
1063221852 10:3976091-3976113 AGTGTCAAATCCATGGGAGTGGG - Intergenic
1069119410 10:64550399-64550421 ATTATGAAGTCAATGGGAGGTGG - Intergenic
1069158922 10:65066139-65066161 ACTATAAAATCTAGAGGAGATGG - Intergenic
1069926778 10:71855980-71856002 ACTATCAAATCAAGGAGAAGGGG - Intergenic
1070207803 10:74281331-74281353 ACTATCAAATCAATGGGAGAGGG - Intronic
1072704331 10:97669424-97669446 ACTATCTGAGTAATGGGAGAAGG - Intronic
1079064535 11:17277473-17277495 AGTATCAAATGGCTGGGAGAGGG + Intronic
1080201899 11:29681478-29681500 ACTATCAAATGAATGGAGCATGG + Intergenic
1081905612 11:46667638-46667660 ACTGGCCCATCAATGGGAGATGG - Intronic
1085155753 11:74292200-74292222 ACTATCAAATCTAGAGGAAATGG - Intronic
1085290474 11:75395744-75395766 GCTATCAAAGCAATGAGAGGAGG + Intergenic
1085785959 11:79449666-79449688 ACTGACAAACCACTGGGAGAGGG + Intergenic
1087886706 11:103490858-103490880 ACTTGCCAAGCAATGGGAGAGGG - Intergenic
1088394156 11:109348408-109348430 AAGAACAAATCAATGAGAGAAGG - Intergenic
1088471381 11:110190827-110190849 ACTAGAAAATCAAGAGGAGATGG + Intronic
1088942321 11:114472261-114472283 ACAATTAAAACAGTGGGAGAGGG - Intergenic
1093095565 12:14967970-14967992 AAAAGCAATTCAATGGGAGAGGG - Intergenic
1099638267 12:85245264-85245286 TCTATTAAATCAATGGTAAAAGG - Intronic
1099900601 12:88706588-88706610 ACTATCAAACCTAGGGGAAATGG - Intergenic
1100163822 12:91893785-91893807 AATGTCAAAGCAATGGGAGAAGG - Intergenic
1100713802 12:97284846-97284868 ACTATCTGATCTATGGAAGAGGG - Intergenic
1102573126 12:113839722-113839744 ACTGTCAAATCAATGCCAGAAGG + Intronic
1103841309 12:123867509-123867531 ACTATCACATCCATGAGATAGGG - Exonic
1104338823 12:127928182-127928204 AACATTAAATAAATGGGAGATGG + Intergenic
1105449593 13:20487122-20487144 ACTATCAAAAAAATGGGATGGGG + Intronic
1108379340 13:49841536-49841558 GCTATTAATACAATGGGAGATGG - Intergenic
1109779484 13:67089354-67089376 GCTATCTCATCAATGAGAGAAGG - Intronic
1109931044 13:69218203-69218225 ATTCTCTAATCAATGTGAGATGG + Intergenic
1115437882 14:33397047-33397069 TCTATCAAATCCATGGGGAATGG + Intronic
1117442848 14:55776097-55776119 ACGATAAAATCAATTGGAAAAGG + Intergenic
1118032983 14:61836565-61836587 AAAAGCAAATCAATGGGAGGTGG - Intergenic
1118750342 14:68802876-68802898 AAAATAAAAACAATGGGAGAAGG + Intergenic
1122272431 14:100574183-100574205 CTTATCTGATCAATGGGAGAGGG + Intronic
1122385047 14:101338961-101338983 ACTTTGAAACCAATGGGAGTGGG + Intergenic
1124872139 15:33553715-33553737 ACTCTCAGATCAAAGGGATAAGG - Intronic
1125214194 15:37250969-37250991 ACTATCAAATATTTGGGAGCAGG - Intergenic
1125323135 15:38509948-38509970 CCCTTCAAATCACTGGGAGATGG + Intronic
1126753980 15:51906408-51906430 ACTAAGAAAACAATGAGAGAGGG - Intronic
1126968878 15:54087303-54087325 TCTATCATATCAGTGGCAGATGG + Intronic
1127215807 15:56822074-56822096 GCTTTGACATCAATGGGAGAGGG - Intronic
1127283101 15:57508931-57508953 ATTAACAAATGATTGGGAGAAGG + Intronic
1127889333 15:63234818-63234840 ATTTTCCATTCAATGGGAGAAGG - Intronic
1129024345 15:72555331-72555353 ACTACCAAAATAATGGAAGAAGG + Exonic
1130853799 15:87823104-87823126 ACAAGCAAATAAATGGCAGAGGG - Intergenic
1131615944 15:94017547-94017569 ACTATCAAAATGATGGGAGAGGG + Intergenic
1131619036 15:94047490-94047512 ACTATAAAATCTGTTGGAGATGG + Intergenic
1131652539 15:94416825-94416847 AGTATGAAATAAATGGGAAAAGG + Intronic
1131706135 15:94998654-94998676 ACTATCTATTCAAGGAGAGAGGG - Intergenic
1134788163 16:16963754-16963776 ACTATTAAAGAAATGAGAGAGGG - Intergenic
1138874418 16:60931877-60931899 ATAAACAAATCAATGAGAGAAGG - Intergenic
1138954279 16:61951882-61951904 ATAATGAAATCAATGGGAAACGG + Intronic
1141140123 16:81491985-81492007 AGTATCTAACCAAAGGGAGATGG - Intronic
1141387550 16:83636064-83636086 AATAGCAATTCAATGGAAGAAGG - Intronic
1142158727 16:88546274-88546296 ACTCTCCAATCAAAGGCAGAGGG + Intergenic
1144164872 17:12600777-12600799 ATTCTCAGATCAATGGGGGAAGG + Intergenic
1149122132 17:53182139-53182161 ACTAGAAAACCAATAGGAGATGG - Intergenic
1149413959 17:56438893-56438915 AACATCACATCAAAGGGAGAAGG + Intronic
1153586620 18:6627777-6627799 ACTCTCAAATCAATGAGTCAGGG - Intergenic
1158121971 18:54058471-54058493 ACTAACCAATCAATCTGAGAGGG - Intergenic
1158271983 18:55726378-55726400 ATTATCAAATCTATCAGAGAAGG + Intergenic
1158923019 18:62215121-62215143 AAAATTAAATCATTGGGAGATGG - Intronic
1160624465 18:80193360-80193382 AATTTCAAATCAAAGGGTGAGGG - Intronic
1163955468 19:20633951-20633973 ATTATCAAAACAAGAGGAGAAGG + Intronic
930419140 2:51128651-51128673 AATATCTTATCACTGGGAGATGG + Intergenic
930466428 2:51755938-51755960 ACCATCATATCAATGGAAGCAGG + Intergenic
930979272 2:57502620-57502642 ACAATCAAATAAATATGAGATGG + Intergenic
931695765 2:64869407-64869429 TCTATGAAATCAGGGGGAGAAGG + Intergenic
937461252 2:122088747-122088769 ACTATAAAATCCAGAGGAGATGG - Intergenic
937952845 2:127401662-127401684 GCTGTCAAATGCATGGGAGAGGG - Intergenic
939630051 2:144518724-144518746 AATTTCAAATCAATAGGACAAGG - Intronic
940437228 2:153669250-153669272 ACCATCAAAGCAATGGCAGGGGG - Intergenic
943774724 2:191752644-191752666 ACTAGAAAATCAATGTGTGAAGG + Intergenic
947709257 2:232301710-232301732 AGTATTTATTCAATGGGAGAAGG + Intronic
1168857662 20:1019960-1019982 ACTGTCAAATAAATGGGTGGAGG - Intergenic
1169513653 20:6293236-6293258 AATACCAAATCAATGGATGAAGG - Intergenic
1170115843 20:12858664-12858686 ACTCTCTAATAAAAGGGAGAAGG + Intergenic
1170804118 20:19615097-19615119 ACAACAAAACCAATGGGAGAAGG - Intronic
1172307429 20:33890955-33890977 ACTATCCAAACAGTGGGAGGTGG - Intergenic
1178024423 21:28449987-28450009 TATATCAGATCAATGGCAGAGGG - Intergenic
1184906584 22:47491217-47491239 ACTAACAAAGCAAGGGGGGAAGG - Intergenic
1185408185 22:50668292-50668314 ACTTCCAAACCAATGGGAGCTGG + Intergenic
949447222 3:4147793-4147815 ATGATCATATCAATCGGAGATGG + Intronic
949714458 3:6913089-6913111 AGTATCAAATGATTAGGAGAGGG - Intronic
950708902 3:14801416-14801438 ACTATCAAGTCAGTGAGAAATGG + Intergenic
952775319 3:37040442-37040464 ACAGTCAAATAAATGGGAAATGG - Intronic
956159316 3:66332283-66332305 AATATCAAAGCATTGGAAGAAGG - Intronic
957345158 3:78950764-78950786 ACTATGAAATCATTTGCAGATGG - Intronic
961153596 3:124660373-124660395 AATTTCAAAGCTATGGGAGAAGG - Intronic
964010076 3:151882419-151882441 ACTATTAAATCAAGAGCAGAAGG - Exonic
964562980 3:158018928-158018950 ACTGACAAATCAGTGGGAGAAGG + Intergenic
964920128 3:161885886-161885908 ATTTTGCAATCAATGGGAGAAGG + Intergenic
966021553 3:175217941-175217963 ACTATCAAATAAAGGGCAGTGGG + Intronic
966672639 3:182545092-182545114 ACCCTCAAATCAGTAGGAGAAGG + Intergenic
975230926 4:71932209-71932231 AATATCAAAGCAAGGAGAGAAGG + Intergenic
977905124 4:102468248-102468270 AATATCAACTAAATCGGAGATGG - Intergenic
978389229 4:108206948-108206970 ACTAGCATATGAATGGGTGAGGG - Intergenic
978470701 4:109064172-109064194 ACTATCACGTTAATGGCAGAGGG - Intronic
984051688 4:174872478-174872500 ACTATAAAATGGATGGGAAAGGG - Intronic
984442896 4:179795244-179795266 ACTATCATATTTGTGGGAGAGGG - Intergenic
986124761 5:4874815-4874837 AGTATCAGATGCATGGGAGAAGG - Intergenic
986420236 5:7573217-7573239 ACTAGCAAATCAATGCAATAAGG + Intronic
986558829 5:9039895-9039917 ACTGTAAAATCAATAGTAGATGG + Exonic
986768420 5:10949392-10949414 TTTACAAAATCAATGGGAGAGGG + Intergenic
987419888 5:17707193-17707215 ACTATGAAATTAATCTGAGAGGG + Intergenic
989289290 5:39743897-39743919 ACTAACATCTCAATGGAAGAGGG - Intergenic
990634971 5:57714998-57715020 ACAAACAAAATAATGGGAGAAGG - Intergenic
990928664 5:61060825-61060847 AGTACCAAATCAAAGGTAGAGGG - Intronic
992707029 5:79406622-79406644 AATCTTAAACCAATGGGAGAAGG + Intronic
992782008 5:80136421-80136443 ATTAGCACAACAATGGGAGAAGG + Intronic
995160070 5:108968639-108968661 ACAATCAAATCAAAGGAATATGG + Intronic
1000493915 5:161953486-161953508 ACTTTCAAATCAACGTGAGGGGG - Intergenic
1001635209 5:173205047-173205069 ACTATCAAAAGAAAGAGAGAAGG - Intergenic
1005696337 6:28355890-28355912 CCTATCAAATCCATGATAGACGG + Intronic
1006573400 6:35024502-35024524 AATATTAAATAAGTGGGAGATGG + Intronic
1009487576 6:64244577-64244599 ACTATAAAGTGAATGTGAGAGGG - Intronic
1012950737 6:105515244-105515266 AGGATCAGAACAATGGGAGACGG - Intergenic
1013216634 6:108033266-108033288 ACTATCAAACCAATGGAGGAAGG - Intergenic
1017305644 6:152915088-152915110 GCCAGCAAAGCAATGGGAGAAGG + Intergenic
1018268586 6:162051885-162051907 ACTTTAAAATCCATGGGACAAGG - Intronic
1019228570 6:170537001-170537023 ACAATCAAAACCATGGGAGTAGG + Intronic
1019855376 7:3600994-3601016 TCTACCACATCAATGGGATAAGG - Intronic
1021405944 7:20267406-20267428 ATAATCCAATCAATGGGAGTGGG - Intergenic
1021533410 7:21674989-21675011 ATTATCAAAGCAGTTGGAGAAGG - Intronic
1022026471 7:26452487-26452509 ACTATAAACTCCATGGGAGCAGG + Intergenic
1024367375 7:48536195-48536217 ACTATCAAAACAATGTTAAATGG + Intronic
1024658062 7:51468762-51468784 ACTATCATGTAAAAGGGAGATGG - Intergenic
1031540501 7:122989325-122989347 ACAATCAAATGAGTGGGCGAGGG + Intergenic
1032007470 7:128314571-128314593 ACTCTTAGATCAATGGCAGAGGG - Intronic
1034568548 7:151935583-151935605 ACCATCACATCAATGAGAAAAGG + Intergenic
1034625721 7:152490897-152490919 ACACTCAAATCAATGTTAGATGG - Intergenic
1037521472 8:19684296-19684318 CATTTCAAATCAATGGGAAAAGG + Intronic
1041212945 8:55570941-55570963 GCTATCAAATTTATTGGAGATGG - Intergenic
1041309777 8:56504026-56504048 AATTTCAAATCAATGGGGAAAGG - Intergenic
1041415292 8:57601300-57601322 AATATAAAATCTATGGCAGAGGG - Intergenic
1046315694 8:112498579-112498601 ACTAGCAATCCAATGGTAGATGG - Intronic
1046571544 8:115972365-115972387 ACCATCAAATCAAAGGGAATTGG + Intergenic
1047932601 8:129745618-129745640 AATATAAAATCAATGGGAAGTGG + Intergenic
1056052961 9:82789106-82789128 ACTCTCACATGATTGGGAGAGGG + Intergenic
1057096461 9:92314778-92314800 AGTATCATATCCATGGAAGATGG - Exonic
1057689949 9:97275082-97275104 ACTATAAAATCTCTGGAAGAGGG - Intergenic
1060286767 9:122260451-122260473 TCTATCAAATAACTGGCAGAAGG + Intronic
1060299193 9:122364478-122364500 ATTATCAGTTCAATGGGAGTAGG + Intergenic
1187536571 X:20146452-20146474 ACTATTAAAGAAATAGGAGACGG + Intergenic
1187716176 X:22104630-22104652 ACTAGCACATCACTGGGTGAGGG + Intronic
1188302899 X:28527432-28527454 ATTGTCAAATCACTGGGAAAAGG - Intergenic
1189078689 X:37945288-37945310 AGTATCAAATCTTTGGGAAAGGG - Intronic
1189226468 X:39417425-39417447 AATGTCAAATCACTTGGAGAGGG - Intergenic
1189522944 X:41789338-41789360 TCTACCAAATCAGTTGGAGAGGG + Intronic
1190340329 X:49290937-49290959 ATTAACAGATTAATGGGAGAGGG - Intronic
1190973801 X:55379597-55379619 ACCAGCAAACCAATGGGGGAAGG - Intergenic
1191194493 X:57706507-57706529 CCCATCAAAAAAATGGGAGAAGG + Intergenic
1192619770 X:72667095-72667117 ACTATCATATCAAAGGGATATGG - Intronic
1193402979 X:81067890-81067912 ACTATAAAATCTAGGAGAGATGG + Intergenic
1198813795 X:140564738-140564760 ACTTTCAATTCAATGGGAAAAGG - Intergenic