ID: 1070207804

View in Genome Browser
Species Human (GRCh38)
Location 10:74281332-74281354
Sequence CACTATCAAATCAATGGGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 2, 3: 4, 4: 129}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070207804_1070207811 5 Left 1070207804 10:74281332-74281354 CCTCTCCCATTGATTTGATAGTG 0: 1
1: 0
2: 2
3: 4
4: 129
Right 1070207811 10:74281360-74281382 CCTTGAGAGCCAGTTCATTGGGG No data
1070207804_1070207812 6 Left 1070207804 10:74281332-74281354 CCTCTCCCATTGATTTGATAGTG 0: 1
1: 0
2: 2
3: 4
4: 129
Right 1070207812 10:74281361-74281383 CTTGAGAGCCAGTTCATTGGGGG No data
1070207804_1070207814 25 Left 1070207804 10:74281332-74281354 CCTCTCCCATTGATTTGATAGTG 0: 1
1: 0
2: 2
3: 4
4: 129
Right 1070207814 10:74281380-74281402 GGGGAAGTTCCCCACTTTTTTGG No data
1070207804_1070207808 3 Left 1070207804 10:74281332-74281354 CCTCTCCCATTGATTTGATAGTG 0: 1
1: 0
2: 2
3: 4
4: 129
Right 1070207808 10:74281358-74281380 GGCCTTGAGAGCCAGTTCATTGG No data
1070207804_1070207809 4 Left 1070207804 10:74281332-74281354 CCTCTCCCATTGATTTGATAGTG 0: 1
1: 0
2: 2
3: 4
4: 129
Right 1070207809 10:74281359-74281381 GCCTTGAGAGCCAGTTCATTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070207804 Original CRISPR CACTATCAAATCAATGGGAG AGG (reversed) Intronic
900913923 1:5621178-5621200 CAATGTCAAAGCAAGGGGAGAGG + Intergenic
904127168 1:28249207-28249229 CTTTATCAAACCAATTGGAGTGG + Intergenic
905105915 1:35563517-35563539 CACTAACAAATCCATGGGCATGG - Intronic
906863861 1:49394223-49394245 CACTAGAAAATCAATGGGGAAGG - Intronic
910298171 1:85674156-85674178 TACTATCAAAGCAAAGGAAGGGG - Intronic
910309964 1:85812283-85812305 CAATGTCAAAGCAATGGGAACGG - Intronic
912967704 1:114250757-114250779 CATTATTAAATCAAAGAGAGAGG + Intergenic
916034310 1:160907558-160907580 CACTTTCAAACCAATGTCAGTGG + Intergenic
917176651 1:172242986-172243008 CAATAACAAAGAAATGGGAGAGG - Intronic
918822463 1:189272118-189272140 CACTATCAAATAAATGATACAGG - Intergenic
920532303 1:206712574-206712596 CCCTAAGAAAACAATGGGAGAGG - Intronic
1063221853 10:3976092-3976114 AAGTGTCAAATCCATGGGAGTGG - Intergenic
1063387977 10:5628344-5628366 CACTCCCAAATCAAGGGAAGAGG + Intergenic
1064720829 10:18226964-18226986 CACTTTCAAATCAAGGAGAATGG + Intronic
1065747328 10:28854364-28854386 CAATAACAAAACAATGGGATAGG + Intronic
1066387764 10:34955342-34955364 CACTGTCAAAGCAAAGGAAGAGG - Intergenic
1069805990 10:71125419-71125441 CATCAGCAAATCAATGTGAGGGG + Intergenic
1069926779 10:71855981-71856003 AACTATCAAATCAAGGAGAAGGG - Intergenic
1070207804 10:74281332-74281354 CACTATCAAATCAATGGGAGAGG - Intronic
1077348326 11:2075328-2075350 CACCATCCATTCCATGGGAGTGG + Intergenic
1079064534 11:17277472-17277494 CAGTATCAAATGGCTGGGAGAGG + Intronic
1079264530 11:18917897-18917919 CACTATTGAATGAATGGGATTGG + Intergenic
1087620461 11:100535523-100535545 CACTATAAAATCAAATGGGGAGG + Intergenic
1087886707 11:103490859-103490881 CACTTGCCAAGCAATGGGAGAGG - Intergenic
1088391984 11:109324556-109324578 CTCTCTCAAACCAAAGGGAGTGG - Intergenic
1093095566 12:14967971-14967993 CAAAAGCAATTCAATGGGAGAGG - Intergenic
1098298211 12:69026404-69026426 CAATATCACATCCCTGGGAGTGG - Intergenic
1100882150 12:99030822-99030844 TAATTTTAAATCAATGGGAGTGG - Intronic
1103039590 12:117684276-117684298 CACTCCCAAACCAGTGGGAGAGG - Intronic
1103841310 12:123867510-123867532 CACTATCACATCCATGAGATAGG - Exonic
1105449592 13:20487121-20487143 AACTATCAAAAAAATGGGATGGG + Intronic
1106852066 13:33804563-33804585 CTGTATCAAATCAATGGAAAGGG - Intergenic
1107374886 13:39793008-39793030 AAATATCAAATCAATTAGAGTGG - Intergenic
1110254854 13:73421829-73421851 CACTAACTAATCATTGTGAGTGG + Intergenic
1113544024 13:111132360-111132382 CACTATCAAATGAATCAAAGGGG - Intronic
1113647779 13:112011215-112011237 CACGGACAAATCCATGGGAGTGG + Intergenic
1116189517 14:41646256-41646278 CAGCATCCAATCAATGGGATAGG - Intronic
1117634598 14:57728761-57728783 CAATAAGAAATCAATGGAAGGGG - Intronic
1122272430 14:100574182-100574204 CCTTATCTGATCAATGGGAGAGG + Intronic
1122385046 14:101338960-101338982 AACTTTGAAACCAATGGGAGTGG + Intergenic
1124627546 15:31317253-31317275 CACCATCAAATCACAGGAAGTGG - Intergenic
1127064003 15:55217949-55217971 CAGATTCAAATCAATGAGAGGGG + Intronic
1129811336 15:78512776-78512798 CCCTATAAAATTAATGGGGGAGG + Intronic
1130709000 15:86261036-86261058 CATGATCAAATGAATGGGTGTGG + Intronic
1131615943 15:94017546-94017568 AACTATCAAAATGATGGGAGAGG + Intergenic
1131706136 15:94998655-94998677 CACTATCTATTCAAGGAGAGAGG - Intergenic
1136747069 16:32600084-32600106 CACTATCAAATATATTTGAGAGG + Intergenic
1137830671 16:51540052-51540074 CACTAACAGCTCAGTGGGAGAGG + Intergenic
1140794239 16:78421563-78421585 CACTATGGAAGCAATGGGATGGG + Intronic
1141484778 16:84331495-84331517 CACGATCATATGAATGGGACTGG + Intergenic
1142158726 16:88546273-88546295 CACTCTCCAATCAAAGGCAGAGG + Intergenic
1203049199 16_KI270728v1_random:859291-859313 CACTATCAAATATATTTGAGAGG + Intergenic
1150290198 17:63976706-63976728 CACTTTAAAAACAATGGCAGTGG + Intergenic
1154179767 18:12124266-12124288 GACTCTCAAATCATTGGAAGTGG + Exonic
1154368062 18:13729469-13729491 CATTAGGAAATCAATGGCAGAGG + Intronic
1155383191 18:25247172-25247194 CACTGACTAATGAATGGGAGAGG + Intronic
1157543912 18:48534440-48534462 CACTCTAAAAAAAATGGGAGGGG - Intergenic
1163668830 19:18615907-18615929 CATTAACCAATGAATGGGAGGGG - Intronic
925483785 2:4305252-4305274 CACTCTCAAAACAATGGCAATGG + Intergenic
931631694 2:64307804-64307826 GACTATCAGGTCAATGAGAGAGG - Intergenic
932274002 2:70437834-70437856 CACTTTCTAAGCAATGGAAGAGG + Intergenic
933271206 2:80234910-80234932 CAATAACAAATAAATGGGTGTGG + Intronic
935819784 2:106883187-106883209 CCCTATCAATTCAATGGGAGGGG + Intronic
936076917 2:109407266-109407288 CCCTTTAAAATCAATGGAAGGGG + Intronic
936881486 2:117256864-117256886 TTCTATCAAATCAAAGGTAGAGG + Intergenic
937952846 2:127401663-127401685 CGCTGTCAAATGCATGGGAGAGG - Intergenic
937975400 2:127579282-127579304 CATTCTCAAAGCAATGGGAAGGG + Intronic
940437229 2:153669251-153669273 CACCATCAAAGCAATGGCAGGGG - Intergenic
943346058 2:186738158-186738180 CACTCTCCAAGCTATGGGAGTGG - Intronic
945682398 2:212930046-212930068 CACTCTCAAAACAAGGGGAGGGG - Intergenic
1169411719 20:5376574-5376596 CAGCATAAAATCAAGGGGAGGGG - Intergenic
1176266377 20:64211594-64211616 CAGTAACAGATCGATGGGAGGGG + Intronic
1176916192 21:14628130-14628152 CAGCATCCAATCAATGGGATAGG + Intronic
1178241641 21:30909332-30909354 CAATATTATATAAATGGGAGGGG - Intergenic
1178370928 21:32027071-32027093 CACTGTCAGCTCCATGGGAGAGG + Intronic
1180566879 22:16677225-16677247 GACTCTCAAATCATTGGAAGTGG - Intergenic
1182740518 22:32564021-32564043 CCCTAGCAAATGGATGGGAGGGG + Intronic
949825136 3:8157137-8157159 CACTTTCATATCCATGGGTGTGG - Intergenic
951214284 3:20009036-20009058 AACAATCAGATCGATGGGAGAGG + Intronic
957177701 3:76832971-76832993 CACAATAAAAACAAAGGGAGAGG + Intronic
959102976 3:102034376-102034398 TACTGTCAAGTCAATGTGAGGGG + Intergenic
960810969 3:121627306-121627328 CACTTTCAAATTTATGGGACAGG + Exonic
963583199 3:147152745-147152767 CACGATCATTTCAATGGAAGTGG - Intergenic
966021552 3:175217940-175217962 GACTATCAAATAAAGGGCAGTGG + Intronic
970284915 4:14501279-14501301 TAATTTCAAAGCAATGGGAGCGG + Intergenic
972573868 4:40334091-40334113 CACAATCAACACAATGGGATAGG + Intergenic
975507320 4:75152296-75152318 CACTATGAAATAAATTGCAGGGG - Intergenic
977399826 4:96518872-96518894 CATTAACAAGTCAATGAGAGAGG - Intergenic
977852215 4:101844141-101844163 CACTATCTAATGAAAGGGACAGG + Intronic
978173093 4:105697566-105697588 CATTATAAAATGAATGGGTGTGG - Intronic
978389230 4:108206949-108206971 CACTAGCATATGAATGGGTGAGG - Intergenic
979206734 4:118046779-118046801 CACTCTCAAAGCACTGAGAGGGG + Intronic
982927983 4:161363975-161363997 CACTATGAATACAGTGGGAGTGG + Intergenic
984102564 4:175502743-175502765 CCCTATTAAATAACTGGGAGGGG - Intergenic
986768419 5:10949391-10949413 CTTTACAAAATCAATGGGAGAGG + Intergenic
987419887 5:17707192-17707214 CACTATGAAATTAATCTGAGAGG + Intergenic
987594903 5:19985242-19985264 CATTATCAAAGCAAAAGGAGGGG + Intronic
992798339 5:80273096-80273118 CACAGTAAAATAAATGGGAGTGG + Intergenic
995530592 5:113088239-113088261 CACTCTCAAATCAAAAGAAGGGG - Intronic
997433386 5:133857059-133857081 CACACTCAACTCAAGGGGAGGGG - Intergenic
998519966 5:142791339-142791361 CACTGGCAAAAGAATGGGAGAGG - Intronic
999010702 5:148035819-148035841 CACTCTCAAATCAATGGCAGGGG + Intronic
1000493916 5:161953487-161953509 TACTTTCAAATCAACGTGAGGGG - Intergenic
1001987193 5:176084644-176084666 CACTATCAAATATATTTGAGAGG + Intronic
1002229675 5:177753503-177753525 CACTATCAAATATATTTGAGAGG - Intronic
1002265670 5:178030274-178030296 CACTATCAAATATATTTGAGAGG + Intronic
1003791664 6:9553201-9553223 CACTGACAATTCAATGGGTGAGG + Intergenic
1004509900 6:16277036-16277058 ATCTAGCAATTCAATGGGAGAGG + Intronic
1004935953 6:20508762-20508784 CACTATCAAACCACAGGGTGAGG + Intergenic
1011040033 6:83019848-83019870 CAGGATCAAATCACTGGCAGCGG + Intronic
1013402561 6:109813211-109813233 CACTCTCAAATGATTGGCAGTGG - Intronic
1016619477 6:146091341-146091363 CACTATCAAAATATTAGGAGGGG - Intronic
1017532687 6:155312615-155312637 CGCTATCAAATCAATGAGCTTGG + Intronic
1017602414 6:156098124-156098146 CACTTTCATATCAAGGAGAGAGG + Intergenic
1020511658 7:9064359-9064381 GACAAGCAAATGAATGGGAGTGG - Intergenic
1021405945 7:20267407-20267429 TATAATCCAATCAATGGGAGTGG - Intergenic
1023212972 7:37828259-37828281 TTCTACCAAATAAATGGGAGGGG - Intronic
1031031133 7:116736387-116736409 CACTTTAAAAACAATGGGGGAGG + Intronic
1031540500 7:122989324-122989346 CACAATCAAATGAGTGGGCGAGG + Intergenic
1032007471 7:128314572-128314594 CACTCTTAGATCAATGGCAGAGG - Intronic
1037257355 8:16970305-16970327 CACTTCAAAATCACTGGGAGTGG + Intergenic
1042141402 8:65682563-65682585 CACTATCAATACAATAGAAGAGG + Intronic
1042827415 8:72992967-72992989 AACTATCATTTCAATGGGAGGGG + Intergenic
1045068164 8:98471142-98471164 CACTATCAGATCAATGGTATCGG + Intronic
1046474474 8:114723531-114723553 CACTATCAAATCTGTGGAATTGG + Intergenic
1050828014 9:9973932-9973954 AAATATCAAATCAATGTCAGTGG - Intronic
1051934233 9:22425282-22425304 CACTGTCAAATTCATGGGATAGG + Intergenic
1058671463 9:107363862-107363884 AACTAATAAATCAGTGGGAGAGG + Intergenic
1059180864 9:112210823-112210845 CATCTACAAATCAATGGGAGAGG + Intergenic
1060304671 9:122400009-122400031 CACTATGAAAGAAATTGGAGAGG + Intergenic
1187185517 X:16981075-16981097 CATTGTTAAATCTATGGGAGGGG + Intronic
1187898720 X:24007575-24007597 CAATATGAAATCAATGGAATAGG - Intronic
1190340330 X:49290938-49290960 CATTAACAGATTAATGGGAGAGG - Intronic
1194481538 X:94432118-94432140 CACCATCACATCATTGGGACTGG - Intergenic
1201633080 Y:16091871-16091893 GACTAAGAAATCATTGGGAGTGG - Intergenic
1201921870 Y:19242573-19242595 AACTAGCAAATCCCTGGGAGTGG + Intergenic