ID: 1070207805

View in Genome Browser
Species Human (GRCh38)
Location 10:74281337-74281359
Sequence CCACTCACTATCAAATCAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 0, 2: 2, 3: 7, 4: 106}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070207805_1070207809 -1 Left 1070207805 10:74281337-74281359 CCCATTGATTTGATAGTGAGTGG 0: 1
1: 0
2: 2
3: 7
4: 106
Right 1070207809 10:74281359-74281381 GCCTTGAGAGCCAGTTCATTGGG No data
1070207805_1070207811 0 Left 1070207805 10:74281337-74281359 CCCATTGATTTGATAGTGAGTGG 0: 1
1: 0
2: 2
3: 7
4: 106
Right 1070207811 10:74281360-74281382 CCTTGAGAGCCAGTTCATTGGGG No data
1070207805_1070207808 -2 Left 1070207805 10:74281337-74281359 CCCATTGATTTGATAGTGAGTGG 0: 1
1: 0
2: 2
3: 7
4: 106
Right 1070207808 10:74281358-74281380 GGCCTTGAGAGCCAGTTCATTGG No data
1070207805_1070207812 1 Left 1070207805 10:74281337-74281359 CCCATTGATTTGATAGTGAGTGG 0: 1
1: 0
2: 2
3: 7
4: 106
Right 1070207812 10:74281361-74281383 CTTGAGAGCCAGTTCATTGGGGG No data
1070207805_1070207814 20 Left 1070207805 10:74281337-74281359 CCCATTGATTTGATAGTGAGTGG 0: 1
1: 0
2: 2
3: 7
4: 106
Right 1070207814 10:74281380-74281402 GGGGAAGTTCCCCACTTTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070207805 Original CRISPR CCACTCACTATCAAATCAAT GGG (reversed) Intronic
905235649 1:36545390-36545412 CCTCTCAAAATCAAATCAACAGG - Intergenic
906729001 1:48065098-48065120 CCACTCTCTATTAAAATAATCGG - Intergenic
907869559 1:58431069-58431091 CCAGTCACTAGCAAAGCAAATGG - Intronic
910575267 1:88755888-88755910 TCACAAACTATCAGATCAATTGG + Intronic
911179151 1:94845798-94845820 CCAACCCCTATCAAATCAGTAGG + Intronic
918637877 1:186800558-186800580 TCTATCCCTATCAAATCAATTGG - Intergenic
920754733 1:208718214-208718236 CCTCTCACTATGAAAGCCATGGG - Intergenic
921184496 1:212657971-212657993 CCACCCACTTACAAATCAAAAGG - Intergenic
922028444 1:221775477-221775499 CCACTCTCTATCCAATTATTAGG - Intergenic
1065862163 10:29881097-29881119 CCACTCCTTATCTAAGCAATGGG - Intergenic
1068994031 10:63181920-63181942 CCACTGACTCTCAAATCTCTGGG + Intronic
1069584712 10:69590962-69590984 CCTCTCACTGTCAAAGCCATAGG - Intergenic
1070207805 10:74281337-74281359 CCACTCACTATCAAATCAATGGG - Intronic
1074658128 10:115617958-115617980 TCACTCACTATCACAAGAATGGG - Intronic
1078648808 11:13168133-13168155 TCACTCATAATCAAATCTATGGG - Intergenic
1080103668 11:28489080-28489102 GCAATCACTACCAATTCAATGGG + Intergenic
1081041694 11:38222010-38222032 CAGCTCACTATCAAATAAACTGG - Intergenic
1081313001 11:41595880-41595902 GCACACACTTGCAAATCAATGGG + Intergenic
1081382745 11:42435728-42435750 CCAATCACTGTCAAATCAATGGG - Intergenic
1085825126 11:79839173-79839195 CCACGCACAGTCAAATAAATAGG + Intergenic
1086632517 11:89040296-89040318 CTATTCACTATCAAATTAACAGG + Intronic
1093478896 12:19584310-19584332 TCACTCACTATCATAAGAATTGG - Intronic
1093777888 12:23098687-23098709 CAACTGACTCTCAAATAAATTGG - Intergenic
1095853327 12:46833170-46833192 CAACTCACTACTAAATAAATGGG - Intergenic
1099124804 12:78740104-78740126 CCAGTGACTTGCAAATCAATGGG + Intergenic
1103666366 12:122569559-122569581 GCACTCATTATTAAATCAGTAGG + Intronic
1105609120 13:21952231-21952253 CTACTCACTTTCATATCACTGGG - Intergenic
1106118333 13:26836728-26836750 TCACTCACTCTCACACCAATGGG - Intergenic
1107656468 13:42596874-42596896 CCAGTCACTATCAGACTAATTGG + Intronic
1107884001 13:44858925-44858947 CTACTAAATATAAAATCAATTGG - Intergenic
1109023127 13:57124147-57124169 CCACAGACTATTAATTCAATTGG - Intergenic
1112127369 13:96482961-96482983 CCACTTACTATCAAATCAGCTGG - Intronic
1113633428 13:111903721-111903743 CCACTCACCATCCTATCCATAGG - Intergenic
1116155642 14:41201055-41201077 CAAATCACTATCAAATGATTTGG + Intergenic
1118726921 14:68635155-68635177 CCCCTCAATTTCAAATGAATGGG + Intronic
1121162701 14:91759823-91759845 TCACTCACTATCACAAGAATAGG - Intronic
1122301756 14:100735395-100735417 CCGCTAAATCTCAAATCAATCGG - Exonic
1130419669 15:83732185-83732207 CCAATTACTATCAAAGCAATGGG - Intronic
1130732662 15:86514935-86514957 CCACTCCATATCAACTCATTGGG + Intronic
1131430774 15:92387220-92387242 ACACTCACTCTGAAATCAATTGG + Intergenic
1137399289 16:48140405-48140427 CCACTGACCATCAAAGCGATTGG + Intronic
1137721336 16:50629374-50629396 CCACTCACTTGCAAATCCACAGG - Intronic
1140236403 16:73163023-73163045 CCAATCACTATCAAATCCTGAGG - Intergenic
1140794237 16:78421558-78421580 CAACTCACTATGGAAGCAATGGG + Intronic
1149840061 17:59954606-59954628 CCACACAATATCAATTCACTAGG + Intronic
1153232725 18:2955406-2955428 CCACACACTTTTAAAACAATTGG + Intronic
1156569648 18:38238923-38238945 CTACTCATTTTCAGATCAATTGG + Intergenic
1158776978 18:60594511-60594533 TCACTCACTATAAAAAAAATAGG + Intergenic
1159187883 18:65002087-65002109 TCACCCACTATCAAATAGATAGG - Intergenic
1159720349 18:71882310-71882332 TGACTCAATATTAAATCAATTGG + Intergenic
1165600844 19:37054954-37054976 CCACTAAATTTCAAATCATTAGG - Intronic
926941831 2:18145398-18145420 CCAGCCACTTTCAAATCACTTGG + Intronic
927411383 2:22830185-22830207 CCCATCACTGTCTAATCAATTGG + Intergenic
929039527 2:37730034-37730056 CCCCTTCCTTTCAAATCAATGGG - Intronic
930835247 2:55785822-55785844 CCACTCAATGTCACTTCAATTGG + Intergenic
931715533 2:65025841-65025863 CCAATCAGTTTCAAAGCAATAGG + Intergenic
933391015 2:81666700-81666722 TCCTTTACTATCAAATCAATCGG - Intergenic
937476805 2:122222562-122222584 CCTCTCACTTTAAAATAAATAGG + Intergenic
937959880 2:127449517-127449539 CCCCTCACTAACACATCAACAGG - Intronic
940168692 2:150803381-150803403 AGACTCATTATCAAGTCAATTGG - Intergenic
940515069 2:154673636-154673658 TCCCTCACTACCAAATCAACAGG - Intergenic
943995931 2:194765618-194765640 CCACTCACTGTGAAAGAAATGGG - Intergenic
1173218721 20:41113455-41113477 CCACTCACTATGAAATCTATAGG - Intronic
1173284136 20:41655141-41655163 CCACAGCCTATCAAATCAACTGG - Intergenic
1174665975 20:52258190-52258212 TCACTCACTATCACAGCAAGGGG - Intergenic
1177869668 21:26556338-26556360 CAACTCACTATCAAAGCCACAGG - Intronic
1178322864 21:31618931-31618953 CCACTCACTATCATGACAACAGG - Intergenic
951745704 3:25974880-25974902 TCTCTCACTATTAAATCACTTGG + Intergenic
951810306 3:26691338-26691360 CCACTGTCCATCAAATCAAATGG - Intronic
953570729 3:44069372-44069394 CCACTCAAAATGTAATCAATGGG + Intergenic
956443757 3:69306104-69306126 CCACCCACAATCTCATCAATAGG + Intronic
958499283 3:94885141-94885163 TCTTTCACTATCAAATAAATGGG - Intergenic
958723838 3:97879109-97879131 CCACTGCCTACCAAATCAAGTGG + Intronic
960726838 3:120678718-120678740 TGAGTCACTATCAAATCAATTGG + Intronic
961093198 3:124133106-124133128 CCCCGCACCATCAGATCAATTGG - Intronic
961368143 3:126414313-126414335 CCACTTACTATAAAATCAGCTGG + Intronic
962153362 3:132917122-132917144 CATCTTACTGTCAAATCAATAGG - Intergenic
969718134 4:8878160-8878182 CCACACACTATGAAATCAGCGGG - Intergenic
970234503 4:13944854-13944876 CCACTGACCATCAGAACAATGGG - Intergenic
971723871 4:30283122-30283144 TCACTCACTAACATATCAGTAGG - Intergenic
972756263 4:42050197-42050219 TCACTCACTGTCAAATCAGATGG + Intronic
977806748 4:101308674-101308696 CCTCTCACTCTCAAAGCACTGGG + Intronic
979371377 4:119891512-119891534 GCACTCAAGATCAAATCACTGGG - Intergenic
980840085 4:138248728-138248750 TCTCTCAATATTAAATCAATAGG + Intergenic
982122654 4:152157487-152157509 CCAGTCACTGTCAGAACAATAGG - Intergenic
983142618 4:164171417-164171439 CCATACACTTTCAAATCAAGTGG - Intronic
984751593 4:183282369-183282391 ACACTCACTATAAAATAACTTGG - Intronic
984775156 4:183475137-183475159 CTACTCACTAGCAAAACAAAGGG + Intergenic
985173801 4:187179233-187179255 CCACTCACTCTCACACCAGTGGG + Intergenic
987594900 5:19985237-19985259 CCATTCATTATCAAAGCAAAAGG + Intronic
991437495 5:66611657-66611679 CCTCTCATTATGAAATCAACTGG - Intronic
994459387 5:100053238-100053260 TCCTTTACTATCAAATCAATTGG - Intergenic
1000996716 5:167966845-167966867 CGAAGCACTTTCAAATCAATAGG + Intronic
1003841922 6:10129436-10129458 TCACTCACTGTAAAATAAATGGG - Intronic
1004465305 6:15879815-15879837 GCAATCACTTTCAAATCTATGGG + Intergenic
1004616902 6:17299358-17299380 CCACTCACTGTCCACTCACTTGG - Intergenic
1009628101 6:66162464-66162486 CACCTCACTATCAAATAAACTGG - Intergenic
1013842582 6:114415288-114415310 CCCCACATTATCAAATAAATTGG - Intergenic
1016322526 6:142861260-142861282 CCATTCATTGACAAATCAATTGG + Intronic
1018591704 6:165432562-165432584 CCATTCACTATTCACTCAATAGG - Intronic
1024717476 7:52096518-52096540 CCACTCACTATCAGAAAAACAGG + Intergenic
1025731045 7:64108189-64108211 CCTCTCACCATTAAAACAATTGG - Intronic
1032169550 7:129573297-129573319 CCACTTACTCTGAAATGAATAGG + Intergenic
1036036173 8:5021673-5021695 CCACACATTACCAAATCAACAGG + Intergenic
1036923312 8:12879135-12879157 CCACTCTCTTTCAGATTAATGGG + Intergenic
1040637536 8:49292464-49292486 CCACACAATATCAAATCACTTGG - Intergenic
1047312243 8:123701933-123701955 CTGCTCAGTATCAAATAAATAGG + Intronic
1051934232 9:22425277-22425299 ACACTCACTGTCAAATTCATGGG + Intergenic
1057967225 9:99516082-99516104 CCACTCACTCTCACATCCTTCGG + Intergenic
1059809793 9:117843502-117843524 ACACTCACTTTAAAATCAAAGGG - Intergenic
1202629888 M:7865-7887 TCCCTTACCATCAAATCAATTGG + Intergenic
1186002629 X:5030289-5030311 CCACTCACTGTCCAAACAATTGG - Intergenic
1186385851 X:9109732-9109754 CCACTCACTACCTAGTCAATAGG + Intronic
1187256599 X:17648675-17648697 CCACTCATTATCATAACCATGGG - Intronic
1191624222 X:63251764-63251786 CCACTTACTATAACATCAAAAGG + Intergenic
1199544625 X:148995019-148995041 CTACACAGTATCAAATGAATGGG + Exonic