ID: 1070207807

View in Genome Browser
Species Human (GRCh38)
Location 10:74281338-74281360
Sequence GCCACTCACTATCAAATCAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 101
Summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 90}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070207807_1070207814 19 Left 1070207807 10:74281338-74281360 CCATTGATTTGATAGTGAGTGGC 0: 1
1: 0
2: 2
3: 8
4: 90
Right 1070207814 10:74281380-74281402 GGGGAAGTTCCCCACTTTTTTGG No data
1070207807_1070207812 0 Left 1070207807 10:74281338-74281360 CCATTGATTTGATAGTGAGTGGC 0: 1
1: 0
2: 2
3: 8
4: 90
Right 1070207812 10:74281361-74281383 CTTGAGAGCCAGTTCATTGGGGG No data
1070207807_1070207809 -2 Left 1070207807 10:74281338-74281360 CCATTGATTTGATAGTGAGTGGC 0: 1
1: 0
2: 2
3: 8
4: 90
Right 1070207809 10:74281359-74281381 GCCTTGAGAGCCAGTTCATTGGG No data
1070207807_1070207808 -3 Left 1070207807 10:74281338-74281360 CCATTGATTTGATAGTGAGTGGC 0: 1
1: 0
2: 2
3: 8
4: 90
Right 1070207808 10:74281358-74281380 GGCCTTGAGAGCCAGTTCATTGG No data
1070207807_1070207811 -1 Left 1070207807 10:74281338-74281360 CCATTGATTTGATAGTGAGTGGC 0: 1
1: 0
2: 2
3: 8
4: 90
Right 1070207811 10:74281360-74281382 CCTTGAGAGCCAGTTCATTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070207807 Original CRISPR GCCACTCACTATCAAATCAA TGG (reversed) Intronic
901573408 1:10180316-10180338 TCTAATCACAATCAAATCAACGG - Exonic
905242137 1:36588239-36588261 CCCTCTCACTATCAAATCCCAGG + Intergenic
905710067 1:40094539-40094561 GGCACTCACTCTCAAATTCAGGG - Intronic
909573297 1:77142726-77142748 CCCACTCACTATCACAAGAATGG + Intronic
911650116 1:100378617-100378639 ACCTCTCACTTTGAAATCAATGG - Intronic
915305141 1:154973019-154973041 GCCACACACCAACAAATCCATGG + Intronic
915942562 1:160128126-160128148 GTCACTAACTAGCAAATCCAGGG + Intronic
917852553 1:179077924-179077946 GACAGTCACTATCATCTCAATGG - Intergenic
919616634 1:199816096-199816118 GCCACACACTTTTAAATCATCGG - Intergenic
920349863 1:205330585-205330607 GCCACTCACCCCCAAATTAAAGG + Intergenic
921559777 1:216643467-216643489 GCCAGTCTCTATGAAATTAAAGG - Intronic
924902201 1:248412701-248412723 CCCACTCACTATCACAAGAATGG - Intergenic
1063831111 10:9954328-9954350 GTCACTGACTTTCAAATCTAGGG - Intergenic
1070207807 10:74281338-74281360 GCCACTCACTATCAAATCAATGG - Intronic
1074219866 10:111425971-111425993 GCCACACACGATGAACTCAAGGG - Intergenic
1075442035 10:122487581-122487603 GCCACTCACTGTAATATAAACGG + Intronic
1081382747 11:42435729-42435751 CCCAATCACTGTCAAATCAATGG - Intergenic
1086872448 11:92055008-92055030 GCCACTCATAATCTAATTAAAGG - Intergenic
1087137300 11:94733923-94733945 TTCACTCAATATCATATCAAAGG - Intronic
1089811208 11:121133252-121133274 GCAACTCACTCTCACATGAAGGG - Intronic
1089907428 11:122055445-122055467 GCTACTTTCTATGAAATCAAAGG - Intergenic
1099077047 12:78122505-78122527 GGCACTCACAGTGAAATCAAGGG - Intronic
1099124802 12:78740103-78740125 GCCAGTGACTTGCAAATCAATGG + Intergenic
1102992609 12:117325925-117325947 GCCATTAACTATAAAATGAAGGG - Intronic
1105609121 13:21952232-21952254 GCTACTCACTTTCATATCACTGG - Intergenic
1106924129 13:34595369-34595391 GCCACACACTTTTAAATCACCGG + Intergenic
1107406391 13:40117905-40117927 TCCACTCACTAACAAACCAAGGG - Intergenic
1114824684 14:26062667-26062689 GCCACACACTTTCAAATGACCGG - Intergenic
1115141509 14:30176770-30176792 GCAACAAACAATCAAATCAAAGG + Intronic
1117245635 14:53882952-53882974 GCCACTCACAATAAAATAAGAGG + Intergenic
1121938052 14:98038780-98038802 TCCACTCAAAATCAAATTAATGG + Intergenic
1125929546 15:43590374-43590396 GCGACACACTAAGAAATCAAAGG - Intergenic
1125942713 15:43690206-43690228 GCGACACACTAAGAAATCAAAGG - Intergenic
1127850375 15:62907007-62907029 CCCACTCACTACTAAAACAAAGG - Intergenic
1130419671 15:83732186-83732208 ACCAATTACTATCAAAGCAATGG - Intronic
1149282527 17:55123996-55124018 ACCAATCATTATCAAATAAAAGG - Intronic
1156900153 18:42291065-42291087 GCCACACAATATCAAATCAAGGG + Intergenic
1158626580 18:59076975-59076997 GGCACTCACTATAAGGTCAAAGG - Intergenic
929615408 2:43303342-43303364 GCCACTCCCTAACTAACCAAGGG + Intronic
930025927 2:47029121-47029143 GGCACTCACACTCAACTCAAGGG - Intronic
937538269 2:122917759-122917781 TCCACTCATCATCAAACCAAAGG + Intergenic
937779156 2:125817613-125817635 GAAAATAACTATCAAATCAATGG - Intergenic
937784428 2:125878538-125878560 GCCACTCACAATCAAAGGAATGG + Intergenic
938779043 2:134568102-134568124 ACCACACACTTTCAAATAAAGGG - Intronic
938922576 2:136008640-136008662 TCCACTCATTGTAAAATCAAAGG - Intergenic
942016298 2:171820286-171820308 GCCACTCACTAAAAAAACTATGG - Intronic
942531532 2:176915380-176915402 ACCACTAACTATAAGATCAACGG + Intergenic
1174665976 20:52258191-52258213 CTCACTCACTATCACAGCAAGGG - Intergenic
1175331881 20:58170586-58170608 GGCACTCACTATTACATCTAAGG - Intergenic
1177352666 21:19964760-19964782 CCCATTCAATATCAAAGCAAAGG - Intergenic
1178237043 21:30855133-30855155 GCCACACACTTTAAAATCCAGGG - Intergenic
1185329142 22:50244217-50244239 GCCACCCACTCTCAAGTCAAAGG + Exonic
953570727 3:44069371-44069393 GCCACTCAAAATGTAATCAATGG + Intergenic
953708535 3:45249640-45249662 ACCTCTGACTATCAAATGAAAGG - Intergenic
958499284 3:94885142-94885164 GTCTTTCACTATCAAATAAATGG - Intergenic
963433404 3:145237871-145237893 GACAGTCACTATCAAGACAAAGG - Intergenic
965359753 3:167724174-167724196 GCTATTTACTATCAAATGAAAGG + Intronic
966021551 3:175217934-175217956 GACAGTGACTATCAAATAAAGGG + Intronic
967093815 3:186160132-186160154 GCCTCACACTATGAAATCATTGG + Intronic
969718136 4:8878161-8878183 GCCACACACTATGAAATCAGCGG - Intergenic
970234505 4:13944855-13944877 GCCACTGACCATCAGAACAATGG - Intergenic
971350120 4:25848272-25848294 GTCAGACACTACCAAATCAAAGG + Intronic
971517709 4:27509371-27509393 GCCAGTCAGTCTCTAATCAACGG - Intergenic
971737191 4:30469388-30469410 ACAACTCAATATCAAAACAAAGG + Intergenic
972090518 4:35275884-35275906 GTCACTCACTATCACGTAAATGG + Intergenic
972842806 4:42951410-42951432 GCTACTAACTGTCAAAGCAAAGG + Intronic
972908320 4:43779567-43779589 GCCAGTTACTATGAAATTAAAGG + Intergenic
975771328 4:77726158-77726180 GCCACTCACTTTGAAATCAAAGG + Exonic
975867208 4:78736440-78736462 CCATCTCCCTATCAAATCAAAGG - Intergenic
978045732 4:104124628-104124650 TTCACTCTCTATCAATTCAAAGG - Intergenic
984334368 4:178369976-178369998 GCCACACACTTTCAAACCATGGG + Intergenic
984775155 4:183475136-183475158 CCTACTCACTAGCAAAACAAAGG + Intergenic
984856371 4:184199361-184199383 GCCACTCACTAGCAGACCATGGG - Intronic
988048613 5:25993120-25993142 TCCTCTCATTACCAAATCAAAGG + Intergenic
989163440 5:38412805-38412827 ACCACTCAGTAGCACATCAAAGG - Intronic
989702776 5:44290296-44290318 GCCACTTTCTATCAAGACAATGG + Intergenic
995177539 5:109196158-109196180 GCCACCCACAGTCAAATGAATGG - Exonic
998071553 5:139201807-139201829 GCCACCATCAATCAAATCAAAGG + Intronic
999010697 5:148035813-148035835 ACCAGCCACTCTCAAATCAATGG + Intronic
1000245375 5:159444540-159444562 GCCACTCACTTTCTCATCATTGG - Intergenic
1000769286 5:165332252-165332274 GCAACTCATTACCAAATGAAAGG + Intergenic
1010228417 6:73513368-73513390 CCCACTAACTATAAACTCAAAGG + Intergenic
1022644125 7:32215185-32215207 TCTACTCCCTATCAGATCAATGG + Intronic
1026978501 7:74513138-74513160 GCCAGTCTCTATCAACTCAGGGG - Intronic
1027819293 7:83023608-83023630 GCCACTCAGTGTCAAGGCAAAGG + Intronic
1033214158 7:139482126-139482148 CCCACTCACTATCTACTGAATGG + Intronic
1042649677 8:71025553-71025575 GACACTCAAAATCAAATTAAAGG + Intergenic
1044374753 8:91456777-91456799 TTCACTCCCTATCAAAACAATGG - Intergenic
1045185955 8:99838239-99838261 ACCACTAACTATCAAATCATGGG - Intronic
1046540989 8:115582649-115582671 GCCACTGACTTTCAAAGGAAGGG - Intronic
1048027784 8:130602392-130602414 GCCACTCACTATGAGATCTTAGG + Intergenic
1048162832 8:132036887-132036909 AGCACACACTATCAAATCATAGG - Intronic
1050115655 9:2260746-2260768 GCCAGTTACTGCCAAATCAAAGG - Intergenic
1059809794 9:117843503-117843525 GACACTCACTTTAAAATCAAAGG - Intergenic
1060363832 9:122988455-122988477 GCCATTCAGTAAAAAATCAAAGG - Intronic
1188167034 X:26874217-26874239 ACCTCTCACTATGACATCAATGG + Intergenic
1191603443 X:63035755-63035777 GCTACTGGCTATCAACTCAAAGG - Intergenic
1195467285 X:105193822-105193844 GCCCTTCACTATCAATTTAAAGG + Intronic
1199259625 X:145756457-145756479 ACCACTCACTGTCCAATAAAAGG - Intergenic
1199544624 X:148995018-148995040 GCTACACAGTATCAAATGAATGG + Exonic
1200895844 Y:8375335-8375357 GACACTCTCTATAAAATCAAGGG + Intergenic