ID: 1070207810

View in Genome Browser
Species Human (GRCh38)
Location 10:74281360-74281382
Sequence CCCCAATGAACTGGCTCTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070207810_1070207818 16 Left 1070207810 10:74281360-74281382 CCTTGAGAGCCAGTTCATTGGGG No data
Right 1070207818 10:74281399-74281421 TTGGTAAAGAAACATAAGCAAGG No data
1070207810_1070207819 17 Left 1070207810 10:74281360-74281382 CCTTGAGAGCCAGTTCATTGGGG No data
Right 1070207819 10:74281400-74281422 TGGTAAAGAAACATAAGCAAGGG No data
1070207810_1070207820 18 Left 1070207810 10:74281360-74281382 CCTTGAGAGCCAGTTCATTGGGG No data
Right 1070207820 10:74281401-74281423 GGTAAAGAAACATAAGCAAGGGG No data
1070207810_1070207821 22 Left 1070207810 10:74281360-74281382 CCTTGAGAGCCAGTTCATTGGGG No data
Right 1070207821 10:74281405-74281427 AAGAAACATAAGCAAGGGGAAGG No data
1070207810_1070207814 -3 Left 1070207810 10:74281360-74281382 CCTTGAGAGCCAGTTCATTGGGG No data
Right 1070207814 10:74281380-74281402 GGGGAAGTTCCCCACTTTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070207810 Original CRISPR CCCCAATGAACTGGCTCTCA AGG (reversed) Intronic
No off target data available for this crispr