ID: 1070207814

View in Genome Browser
Species Human (GRCh38)
Location 10:74281380-74281402
Sequence GGGGAAGTTCCCCACTTTTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070207807_1070207814 19 Left 1070207807 10:74281338-74281360 CCATTGATTTGATAGTGAGTGGC 0: 1
1: 0
2: 2
3: 8
4: 90
Right 1070207814 10:74281380-74281402 GGGGAAGTTCCCCACTTTTTTGG No data
1070207805_1070207814 20 Left 1070207805 10:74281337-74281359 CCCATTGATTTGATAGTGAGTGG 0: 1
1: 0
2: 2
3: 7
4: 106
Right 1070207814 10:74281380-74281402 GGGGAAGTTCCCCACTTTTTTGG No data
1070207804_1070207814 25 Left 1070207804 10:74281332-74281354 CCTCTCCCATTGATTTGATAGTG 0: 1
1: 0
2: 2
3: 4
4: 129
Right 1070207814 10:74281380-74281402 GGGGAAGTTCCCCACTTTTTTGG No data
1070207803_1070207814 26 Left 1070207803 10:74281331-74281353 CCCTCTCCCATTGATTTGATAGT 0: 1
1: 0
2: 0
3: 8
4: 152
Right 1070207814 10:74281380-74281402 GGGGAAGTTCCCCACTTTTTTGG No data
1070207810_1070207814 -3 Left 1070207810 10:74281360-74281382 CCTTGAGAGCCAGTTCATTGGGG No data
Right 1070207814 10:74281380-74281402 GGGGAAGTTCCCCACTTTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070207814 Original CRISPR GGGGAAGTTCCCCACTTTTT TGG Intronic
No off target data available for this crispr