ID: 1070208770

View in Genome Browser
Species Human (GRCh38)
Location 10:74292629-74292651
Sequence TTTTATCCTGAATAACGAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 173
Summary {0: 1, 1: 0, 2: 4, 3: 14, 4: 154}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070208770 Original CRISPR TTTTATCCTGAATAACGAGA AGG (reversed) Intronic
903068345 1:20713835-20713857 TTTTAACCTGAATAACGAGGAGG - Intronic
903314280 1:22489022-22489044 TTTTAGTCTGAAGAACTAGAAGG + Intronic
904205056 1:28848966-28848988 TTGTATCCTGCACAACCAGATGG + Intronic
907082324 1:51635088-51635110 ATTTCTCCTGCATAACAAGACGG - Intronic
907684221 1:56594296-56594318 TTTTAGCCTGAATAACTAGAAGG + Intronic
908321041 1:62979146-62979168 TTTTTTCCTGAAAAGAGAGAAGG - Intergenic
910477950 1:87626989-87627011 TCTTATCCTGAATAATAGGAAGG - Intergenic
910575461 1:88758084-88758106 GATTATCCGGAATAACTAGATGG + Intronic
911414870 1:97558632-97558654 GTTTATCCTGAATAGGGTGAGGG - Intronic
912997208 1:114542932-114542954 TTTTCTTCTGAATAACTTGATGG + Intergenic
916755488 1:167765882-167765904 TTTTATCCTGAAGCAAAAGAAGG - Intronic
917405163 1:174697787-174697809 TTGTATCCTAAATAACCAAACGG + Intronic
918180041 1:182079521-182079543 TTTTGGCCTGAACAACCAGAAGG + Intergenic
918699358 1:187588528-187588550 TTTTATGCTTAATAATGAGTTGG + Intergenic
918706745 1:187672509-187672531 TTGTATTCTGAATAACTAGTTGG + Intergenic
920948486 1:210551545-210551567 TTTTATCTTGAATAATGAAGGGG - Intronic
921802874 1:219421300-219421322 TTTTACCCTGAAAAACATGATGG - Intergenic
1062808882 10:447319-447341 TGTGATCCTGAATATCGACAGGG - Intronic
1062809131 10:448668-448690 TGTGATCCTGAATATCGACAGGG - Intronic
1063849623 10:10171833-10171855 TTATATCCAAAATAAGGAGAAGG - Intergenic
1064930490 10:20620452-20620474 TTTTGGCCTGAAAAACTAGAAGG - Intergenic
1065414456 10:25469412-25469434 TTTTGGCCTGAGTAACTAGAAGG - Intronic
1067987596 10:51167257-51167279 TTTGAACCTGAATGACAAGAAGG + Intronic
1070208770 10:74292629-74292651 TTTTATCCTGAATAACGAGAAGG - Intronic
1070375555 10:75827745-75827767 TTATTTCCTGGATAACAAGATGG - Intronic
1070988797 10:80713384-80713406 TTTTCTCCTGAGAAAAGAGAGGG - Intergenic
1071256830 10:83878830-83878852 ATTTCCCCTGAATAACAAGATGG + Intergenic
1072172246 10:92876571-92876593 TTTTAACCTAAAAAAAGAGAGGG + Intronic
1073677515 10:105665246-105665268 TGTTATCCTGACAAACGAGAGGG + Intergenic
1076397296 10:130149479-130149501 TTTTATTCTGAATAAACACAAGG - Intronic
1079843827 11:25437676-25437698 TATTATTCTGAATTTCGAGATGG - Intergenic
1079885818 11:25987622-25987644 GTTTAGCCTAAATAACTAGAAGG + Intergenic
1081482339 11:43501513-43501535 TTTTGATCTGAATAACTAGATGG - Intergenic
1084168149 11:67386735-67386757 TTTTTTCCTGAATAAAATGAGGG - Intronic
1084187897 11:67484717-67484739 TTTTGCCCTGAACAACGGGAAGG - Intronic
1086588405 11:88482889-88482911 TTTCCTCCTGAATAACGAGAAGG + Intergenic
1086660218 11:89407014-89407036 TTTATTCCTGAATAAGTAGAAGG + Intronic
1086828518 11:91529882-91529904 TTTGATCCTGAATGACCAGTGGG + Intergenic
1087852836 11:103052536-103052558 TTTTATCCTGTGTAATAAGAGGG + Intergenic
1090093541 11:123722220-123722242 TTTTATCTTTAATAACAAAAAGG - Intergenic
1090311775 11:125747490-125747512 TTTTAGCCTGAAAAATGGGAGGG - Intronic
1091014326 11:132036487-132036509 TTTTATAATGAAAAAGGAGAGGG + Intronic
1091131941 11:133153713-133153735 TTTTAAACAGAATAAGGAGATGG - Intronic
1091916309 12:4273602-4273624 TGTTCTCCTTAATAACGAGAGGG + Intergenic
1092920050 12:13223145-13223167 TTTTATCCTGCACAACCTGAAGG - Intergenic
1096323017 12:50632000-50632022 TTTTTTCCTAAATAGAGAGAAGG + Intronic
1099920147 12:88947244-88947266 TTTTAGCCTGATTTACGTGATGG + Intergenic
1103368235 12:120398535-120398557 TTTTATCATGAATGAAGAGCAGG - Intergenic
1105325985 13:19370940-19370962 GTTTGCCCTGAATAACTAGAAGG + Intergenic
1105867518 13:24474133-24474155 GTTTGCCCTGAATAACTAGAAGG - Intronic
1106854158 13:33829746-33829768 TTTCATCCTGGATAATGAGAAGG + Intronic
1107183454 13:37489133-37489155 TTTTATCCTGTAAAAGAAGAAGG - Intergenic
1111529913 13:89523118-89523140 TTTTCTCCTGAATTTCTAGAAGG + Intergenic
1112501391 13:99945998-99946020 TTTCATCCCGAATAGCAAGAGGG - Intergenic
1113291089 13:108906930-108906952 CTTGATCATGAATAATGAGATGG + Intronic
1114825202 14:26069060-26069082 TTTACTCCTGAATAAAGAGAAGG - Intergenic
1115458980 14:33637739-33637761 TTTTGTGCTTAATAATGAGACGG - Intronic
1115622150 14:35151490-35151512 TTTTGACCTGAATAGCTAGAAGG - Intronic
1116380786 14:44265133-44265155 TTTTATCCTGAAAAACTGGAAGG + Intergenic
1117863669 14:60122017-60122039 TTTTGGCCTGAACAACCAGAAGG - Intronic
1120093250 14:80358685-80358707 TTTTGTCCTGAAAACCAAGAAGG - Intronic
1130974873 15:88766434-88766456 TTTTATCCTGAATAAGCAGAAGG - Intergenic
1131342485 15:91615543-91615565 TTTTATCCTGAACAATTACAAGG + Intergenic
1139798422 16:69501440-69501462 TTTTTTCCTGAACAACTTGAAGG + Intergenic
1140177745 16:72680892-72680914 TCTTATCCTGACTAATGAAAAGG - Intergenic
1141785405 16:86196709-86196731 TTTAATTCTAAATAACAAGAGGG - Intergenic
1142179023 16:88658238-88658260 CCTTATCCTGAATAAAGAGACGG + Intronic
1148429143 17:47627659-47627681 TTGTATTTTGTATAACGAGACGG - Intergenic
1156028795 18:32689028-32689050 TTTTAGCCTGAATAACTGAATGG + Intronic
1156992958 18:43432170-43432192 TTTTATCCTTAATAATCACAGGG - Intergenic
1158582220 18:58693679-58693701 TTTTGTCCTGAGTAACCAGATGG + Intronic
1160101823 18:75927658-75927680 TTTTGTCTTAAATAATGAGAGGG - Intergenic
927692149 2:25215953-25215975 ATTTATCCTAAAAAACGACAAGG + Intergenic
928803372 2:35121859-35121881 CTTTATGCTGAATAAAGAAATGG - Intergenic
930321636 2:49862099-49862121 TTTTTTCCTTAATAAGGTGAAGG - Intergenic
932126482 2:69149668-69149690 TTTTACCCTGGAGAACTAGAGGG + Intronic
933456474 2:82525808-82525830 TTTTGTCCTTAATAACCACATGG - Intergenic
934869647 2:97851352-97851374 TTTTGTCCTGAGCAACTAGAAGG - Intronic
935597151 2:104887919-104887941 TTTTATTCTGAATAACAATTAGG + Intergenic
936444701 2:112586418-112586440 CTTTACCCTGAACAACCAGAAGG - Intronic
936964244 2:118111759-118111781 TTTTATCTTGAGAAACTAGATGG + Intergenic
937559483 2:123204770-123204792 TATGCTCCTGAATAACCAGAGGG - Intergenic
939142736 2:138375412-138375434 TTTTATCGTGTAAAAGGAGATGG - Intergenic
939381534 2:141442806-141442828 TTTTATACTGAATAAAGAAAAGG - Intronic
943383658 2:187177813-187177835 TTTCATCCTAAAGAAAGAGATGG + Intergenic
943842805 2:192602111-192602133 TTTTGTCCTTAATAACCACATGG + Intergenic
946305397 2:218854162-218854184 TTTTAACCTGATTAACTGGATGG - Intergenic
948710762 2:239824088-239824110 TTTAATTCTGATTAACGTGATGG + Intergenic
1170155047 20:13261773-13261795 TATTATCCTAATTAAGGAGATGG - Intronic
1177863853 21:26488833-26488855 TTGTATCCTTAATAACAACATGG + Intronic
1177922141 21:27165216-27165238 TTTTCTCCTGATTAAGGAGAAGG + Intergenic
1178571350 21:33740079-33740101 TTTTCACATGAATAACTAGATGG + Intronic
1181314970 22:21964968-21964990 TTTTCTCCTTAGTAACGAGGAGG - Intronic
1182961989 22:34483843-34483865 TATTATCCTGAATTATGAGTGGG + Intergenic
1183117329 22:35702058-35702080 TTTTGTCCTTAATAACCACATGG - Intergenic
1183955449 22:41377756-41377778 TTTTCCCCTGGATAACCAGAGGG - Intronic
952094067 3:29927123-29927145 TTTCATACTAAATAATGAGAAGG + Intronic
952642687 3:35616606-35616628 CTTGATCCTGAATAACATGAGGG + Intergenic
955236226 3:57142285-57142307 TTTTACCCTGAATTCCCAGAAGG - Intronic
958017492 3:87957962-87957984 TTTTATCCTAATAAACTAGAAGG - Intergenic
958162136 3:89831253-89831275 TCTTATCCTGAATGACAATATGG + Intergenic
958518409 3:95152315-95152337 TTTTATCCTTATTAACTTGAAGG + Intergenic
964192210 3:154016399-154016421 TGTTTTCCTGAATAACCAGTTGG - Intergenic
964409136 3:156379974-156379996 TTTCAGCCTGAATAACTAGAAGG + Intronic
967513149 3:190336092-190336114 TTTTCTCCTGAGTAACCAAAAGG - Intronic
968297293 3:197586516-197586538 TTTTGTCCTGAGTAACTGGAAGG + Intergenic
970083439 4:12316894-12316916 TTCTATTCTGAATAACTAGGGGG - Intergenic
971978086 4:33716879-33716901 TTTTATCCTGAGAAAAGAGGTGG - Intergenic
972350277 4:38230517-38230539 TTTCATCCTGATGAACCAGATGG + Intergenic
972909903 4:43801508-43801530 TATTCTCCTGAATAACCAGCGGG + Intergenic
974122621 4:57657910-57657932 TGTTTGCCTGAATAACTAGATGG - Intergenic
974217090 4:58862643-58862665 TTTTTTCCTAAATAACCACATGG - Intergenic
974506047 4:62773413-62773435 TTTTAGCCTGATAAACCAGAAGG + Intergenic
980299416 4:130967930-130967952 TTTTATGTTGAACAACTAGAAGG - Intergenic
981562099 4:146059164-146059186 TTTTATCCTGAACAAATGGAAGG - Intergenic
981969216 4:150646262-150646284 TTTTAGCATGAGCAACGAGAAGG + Intronic
984157994 4:176215343-176215365 TTTTTTCCTGAATAAACAGGAGG + Exonic
985355279 4:189112317-189112339 ATTTTTACTAAATAACGAGAAGG - Intergenic
986969621 5:13316665-13316687 TTTTATCTAGAATGAAGAGATGG - Intergenic
989151128 5:38300930-38300952 TTTTAGCCTGAGCAACTAGAAGG + Intronic
990900856 5:60747371-60747393 TTTTAGCCTGAATAACTGGAAGG + Intergenic
993222304 5:85115225-85115247 TTTTATTCTTAATCACTAGATGG - Intergenic
995006627 5:107204488-107204510 CTCTTTCCTGAATAACGTGAAGG - Intergenic
995369901 5:111407456-111407478 GATTATCATGAATAAAGAGAAGG + Intronic
997140885 5:131379696-131379718 TTTTATTCTGCATAAGGTGAAGG - Intronic
997413225 5:133705782-133705804 TTGGATCCTGAATAATGTGAGGG - Intergenic
998895366 5:146793179-146793201 TTTTGGCCTGAAGAACTAGAAGG + Intronic
1001572425 5:172738867-172738889 TTGTATCCTTAATAAAGACAGGG - Intergenic
1001677380 5:173529925-173529947 TTTTCTCCCTAATAACAAGATGG + Intergenic
1001718967 5:173840960-173840982 TTTTACTCTGAAGAACCAGACGG + Intergenic
1001819752 5:174700712-174700734 CTTGATCCTGAGTAACTAGAGGG + Intergenic
1005336391 6:24800848-24800870 TTTTTACCTGAACAACTAGAAGG - Intronic
1007296103 6:40822043-40822065 TTTTATGCTTAAAAAAGAGAAGG - Intergenic
1009445239 6:63734668-63734690 TTTTGTCCTGAGAAACTAGAAGG + Intronic
1009901656 6:69814411-69814433 TTTAGCCCTGAATAACAAGAAGG + Intergenic
1010850126 6:80764679-80764701 TTTTCTCCTGGGTAACAAGAGGG - Intergenic
1011409241 6:87049446-87049468 TTTTTGCCTGAACAACTAGAAGG + Intergenic
1014397888 6:120949079-120949101 TTTTGTCCTGATCAACTAGATGG - Intergenic
1014909882 6:127079003-127079025 TTTTGTCCTGAGTAACTAGAAGG - Intergenic
1016079866 6:139843044-139843066 TTTTATCTTGGATAACTGGAAGG - Intergenic
1016260536 6:142164385-142164407 TTTTCTCCTTAATACCTAGATGG + Intronic
1018776654 6:167023404-167023426 TTTTAGCCTGCAAAACTAGAAGG + Intronic
1021203597 7:17753375-17753397 TTGCATCCTGAATAACCAGCAGG - Intergenic
1021762849 7:23918165-23918187 TTTTAGCTTGAATAACTGGATGG - Intergenic
1022880909 7:34586503-34586525 TTTTCTCCTGAATAGCCTGAAGG - Intergenic
1023577443 7:41643595-41643617 TTATATCCTGGATAATGAGATGG + Intergenic
1028534445 7:91876424-91876446 TTTTATGCTTAATTAGGAGAAGG - Intronic
1028813024 7:95110494-95110516 TTTTTTCCTGTATTAAGAGAGGG + Intronic
1030106661 7:105993287-105993309 TTTAATCCTCAATAACATGAAGG + Intronic
1032513691 7:132491820-132491842 TTTTTCCCTAAATAAGGAGATGG + Intronic
1037387310 8:18357159-18357181 TTTTCCCCTGGATAACAAGATGG + Intergenic
1039344486 8:36688935-36688957 TTTTATCCAGAAGAAGGTGATGG - Intergenic
1039902574 8:41763757-41763779 TTTTATCCTCAGTGACAAGAAGG - Intronic
1047569960 8:126086869-126086891 TTTTTTCCTGAATGAAGAGATGG - Intergenic
1048389038 8:133943072-133943094 TTTGTTCCTGAACAAGGAGAAGG + Intergenic
1048431186 8:134372852-134372874 TTTTGTCTTGAATAACTAAAGGG - Intergenic
1050902786 9:10967058-10967080 TTTTGTCCTTAATAACCACATGG + Intergenic
1051829535 9:21259819-21259841 TTTTATTCTTTATAACAAGAGGG - Intergenic
1052732647 9:32307690-32307712 TTTGATCCTGAACAACAAAATGG + Intergenic
1053737809 9:41112599-41112621 TTTTGTCCTTAATAACCACATGG + Intergenic
1054690540 9:68318721-68318743 TTTTGTCCTTAATAACCACATGG - Intergenic
1055670515 9:78600890-78600912 TCTTCTTCTGAATAAAGAGAGGG - Intergenic
1058521673 9:105818762-105818784 TTTTGTCCTTAATAACCACATGG + Intergenic
1059268086 9:113054670-113054692 TTTTAACCTGAAGAACCGGATGG - Intronic
1060702767 9:125773239-125773261 TTTTAAACTGAAAAATGAGAAGG + Intronic
1186734831 X:12450937-12450959 TTTTTTCCTGAATAAGATGAGGG - Intronic
1189088970 X:38057966-38057988 TTTTTTCCTGGATTACTAGAGGG + Intronic
1191703046 X:64063859-64063881 TTTTATCCTGAATATGGGGTTGG + Intergenic
1193354306 X:80499677-80499699 GATTTTCCTGAATAACTAGAGGG - Intergenic
1194479103 X:94398127-94398149 TATGATCCTGAATAACCAGTGGG - Intergenic
1195489108 X:105445644-105445666 TATTCTCCTGAATAAGCAGAGGG - Intronic
1196891391 X:120294120-120294142 TTTTATCCTGAATCATATGAAGG - Intronic
1198545616 X:137689653-137689675 TTTCAACTTGAATAACTAGATGG - Intergenic