ID: 1070215478

View in Genome Browser
Species Human (GRCh38)
Location 10:74375126-74375148
Sequence ATTTATATGCAGAAAGTGTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 421
Summary {0: 1, 1: 0, 2: 1, 3: 30, 4: 389}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070215478 Original CRISPR ATTTATATGCAGAAAGTGTA AGG (reversed) Intronic
900903485 1:5533771-5533793 ATTTATATACACAAAGTTTAGGG + Intergenic
904794342 1:33047797-33047819 ATTTCTAGGCAGAAGGTTTAAGG - Intronic
905505190 1:38473730-38473752 ATTTATAGACAGAAAATGAATGG + Intergenic
908026369 1:59956084-59956106 ATATATAGGGAGAAAGTGAATGG + Intergenic
909328523 1:74383457-74383479 AGTTTTATGGAGAAAGTGTGAGG - Intronic
909558116 1:76978201-76978223 GTTAATATGCAGAATATGTAAGG - Intronic
911320984 1:96413736-96413758 AGCTATCTGCAGAAAGTGGATGG + Intergenic
911924219 1:103807566-103807588 ATTTATATCTACAAAATGTACGG - Intergenic
911995354 1:104758694-104758716 AATTATATGCAGATAGTAAAAGG + Intergenic
915968878 1:160337856-160337878 CTTTATATGAATAAATTGTATGG - Intronic
917528505 1:175811239-175811261 AATTATATGAAGACAGTCTAAGG - Intergenic
918934667 1:190906115-190906137 ATTAATATGCAGAAAATACATGG - Intergenic
919000122 1:191820437-191820459 ATTTATATGCCTATAGTGCATGG - Intergenic
919264336 1:195241570-195241592 ATTTATATGCTGACAGTATATGG + Intergenic
919337173 1:196250734-196250756 ATTAATAACCAGAATGTGTAAGG + Intronic
921014693 1:211178045-211178067 ATCTAAATGCAGAAAAGGTACGG + Intergenic
921181892 1:212637926-212637948 GTTTAAAGGCAGAGAGTGTATGG - Intergenic
923197494 1:231682625-231682647 ATGTATATGCACACAGTTTATGG - Intronic
1063779678 10:9307048-9307070 ATTTATATGCAGATAGACCAAGG - Intergenic
1064887889 10:20132696-20132718 ACTCATATGCTGAAAGTGAAAGG - Intronic
1065758469 10:28958111-28958133 ATTAATATCCAGAATGTATAAGG + Intergenic
1067333138 10:45340215-45340237 AGTTATATGCAGAAAATGGCAGG - Intergenic
1068412438 10:56674737-56674759 ATACATGTGCAGAACGTGTAAGG + Intergenic
1070215478 10:74375126-74375148 ATTTATATGCAGAAAGTGTAAGG - Intronic
1071033656 10:81216014-81216036 AATTATATATAGAATGTGTAAGG + Intergenic
1071128397 10:82362958-82362980 ATTTATGTTCAGCAATTGTAAGG + Intronic
1071962199 10:90818003-90818025 ATCTATAGACAGAAAGTGAATGG + Intronic
1073967721 10:109010888-109010910 ATTTATATGCATGAATTGTGAGG - Intergenic
1074215550 10:111380748-111380770 ATTTATTGGAAGAAAGTGTGTGG + Intergenic
1074459452 10:113624137-113624159 ATTCACATGCAGAAAGGGAAAGG - Intronic
1075265058 10:120993388-120993410 ATTTACATGCAAAATGTGCAAGG + Intergenic
1078137908 11:8667465-8667487 ATTGGTATCCAGAATGTGTAAGG + Intronic
1078392461 11:10947790-10947812 AATTCTATGCAGAAAGTCAATGG + Intergenic
1079414730 11:20223180-20223202 ATTTATAGGCAGAAAGACAAAGG - Intergenic
1079768343 11:24424276-24424298 ATTTGTATGCAGAATATATAAGG + Intergenic
1080058332 11:27930929-27930951 TTTTATATGCAAGGAGTGTAAGG - Intergenic
1080135347 11:28847854-28847876 ATTTGCATGGAGAAAATGTATGG - Intergenic
1081166489 11:39814541-39814563 AATTCTATGAAGAAAGTGAATGG - Intergenic
1081822713 11:46015223-46015245 ATTAATATCCAGAATCTGTAAGG - Intronic
1083505461 11:63153017-63153039 ATTTCTGTGAAGAAAGTGAATGG + Intronic
1084956187 11:72692881-72692903 ATGTATGTGCAGAAGGTGGAGGG + Intronic
1087023185 11:93623675-93623697 ATTTATATGCAGAAATAATGAGG - Intergenic
1087401941 11:97678447-97678469 ATTAATAACCAGAATGTGTAAGG - Intergenic
1090038903 11:123273148-123273170 ATTTGAATGCAGAAGGTTTATGG - Intergenic
1090433017 11:126662526-126662548 CCTTATATGCAGAAGGTGGAAGG + Intronic
1091317897 11:134628295-134628317 AATAATATGCAGAAACAGTATGG - Intergenic
1092105170 12:5916308-5916330 ATGTACATGCAGAACGTGAATGG + Intronic
1092571478 12:9728085-9728107 ATTTATATGCAGAATCTCAAAGG - Intronic
1092962939 12:13613459-13613481 ATTCATACTCAGAAAGTGTCAGG + Intronic
1093846361 12:23976711-23976733 TTTTATATGCATGGAGTGTAAGG + Intergenic
1094019959 12:25903634-25903656 AATAATATGCATAAAGTGTCTGG + Intergenic
1094631677 12:32181568-32181590 ATTTATATGCATAAAATGAGAGG - Intronic
1095368163 12:41433435-41433457 ATTTAACTGCAGAAAATGTTAGG + Intronic
1096733809 12:53636557-53636579 ATTTATAGGCTGAAAGTAAAAGG - Intronic
1096960673 12:55573936-55573958 ATTTATATGAAAAAAAGGTAGGG + Intergenic
1097278984 12:57832877-57832899 ATTTCTATGCTGAAATTGGAGGG + Intronic
1097622940 12:61963694-61963716 AATTATGTGCAGAAAGTCAATGG - Intronic
1097937445 12:65269643-65269665 AATCATATCCAGAAACTGTATGG - Intergenic
1098533192 12:71565015-71565037 AATTATATGCATAAAGTACATGG + Intronic
1098609925 12:72444025-72444047 CTTTATATGCAAAAAGAGGAAGG - Intronic
1099217577 12:79872010-79872032 ATTTCAAGGCAGAAACTGTATGG - Intronic
1099530557 12:83774863-83774885 ATTAATATCCAGAATATGTAAGG + Intergenic
1100768183 12:97892248-97892270 ATTTATATGCTTAAAGTGTTGGG - Intergenic
1101555516 12:105805214-105805236 ATTTCTATGCAGAAGGTGATAGG - Intergenic
1102714196 12:114955833-114955855 ATTTACATGTAGAAAATGTTGGG + Intergenic
1103870883 12:124090728-124090750 ATTCAGCTGCAGAAAGTGAATGG + Intronic
1104234653 12:126922036-126922058 ATCTATATCCAGGAAGAGTAAGG + Intergenic
1105234792 13:18539563-18539585 GTTTCTATGCAGAAATTGCATGG + Intergenic
1105266887 13:18827364-18827386 GTTTATTTACAAAAAGTGTATGG - Intergenic
1105985118 13:25558292-25558314 TTTTACATGCAGTAAGTCTAGGG - Intronic
1106854590 13:33835855-33835877 ATTTAACTGCACAAAGTGCAAGG - Intronic
1107895192 13:44955075-44955097 ATATATATGCAACAAGTTTATGG - Intronic
1108166466 13:47698506-47698528 GTCTAGATGCAGAAATTGTATGG + Intergenic
1108761396 13:53570165-53570187 ATGGATATGCAGAAAGGGGAAGG - Intergenic
1109111367 13:58323584-58323606 TTTTAAACACAGAAAGTGTAGGG + Intergenic
1109747255 13:66641397-66641419 ATTTGTATGGAGAAAGTGCATGG + Intronic
1109933294 13:69245202-69245224 AGTTATTTGCAGATAGTGTCAGG + Intergenic
1110245187 13:73315512-73315534 ATTGATATCCAGAATATGTAAGG + Intergenic
1110309218 13:74027804-74027826 TTTTATGTGAAGAATGTGTATGG - Intronic
1111319835 13:86612774-86612796 TTTAATATGCAGAATGTATAAGG - Intergenic
1111774214 13:92638980-92639002 ATTTATATGTAGAATTTATATGG - Intronic
1112976753 13:105329343-105329365 ATTTATAAGCAGAATGCATAAGG + Intergenic
1114995022 14:28338157-28338179 ATTTATATGCACAATCTGTTAGG - Intergenic
1115173263 14:30532558-30532580 ATTTATATGCATAAAGGACAAGG + Intergenic
1115483931 14:33890761-33890783 ATATATAGGCTGAAAGTGAAAGG + Intergenic
1116149868 14:41127274-41127296 ATTTGTATGCAGCCTGTGTATGG - Intergenic
1116233256 14:42245537-42245559 GTCTATATGCAAAATGTGTAAGG - Intergenic
1116307570 14:43277706-43277728 CTTCATTTGCATAAAGTGTAAGG - Intergenic
1116759112 14:48989046-48989068 ATATTTTTGCAGAAAGTTTAGGG + Intergenic
1118173728 14:63415963-63415985 ATTTCTTTTCAGAAAGTTTATGG + Intronic
1118569490 14:67178867-67178889 ATTTATCTGCAGAAACCTTAAGG + Intronic
1118626963 14:67668424-67668446 ATTCAAAGGCAGAAAGTGAATGG + Intronic
1119647341 14:76357194-76357216 ATCTATATCCAGAAATTTTAAGG + Intronic
1119966517 14:78922511-78922533 ATTTAGATGCAGATGGTATAAGG + Intronic
1120284395 14:82479982-82480004 ATTTTTATTCTGTAAGTGTAAGG - Intergenic
1120420948 14:84284924-84284946 ATTTATGTGCAGATATTTTATGG + Intergenic
1120731385 14:88006171-88006193 ATTTCTTTTCAGAAAATGTAGGG + Intronic
1121388179 14:93549865-93549887 ATGTATATGTAGAAACTGTTGGG + Intronic
1122289183 14:100670616-100670638 TTTTGTTTGCAGAAAGTGAAAGG - Intergenic
1124992082 15:34685105-34685127 ATTCATATGCAGAAAAAATATGG + Intergenic
1125107297 15:35987368-35987390 ATTTTTATTCAAAAAGTGTCTGG + Intergenic
1127466991 15:59253797-59253819 ATTAATTTACAGAAAATGTAGGG + Intronic
1128381010 15:67112508-67112530 ATTTATATCCAGAATATATAAGG - Intronic
1130362384 15:83202137-83202159 ATTTATATTAATAAAGGGTATGG + Intronic
1131330524 15:91495076-91495098 ATTTATATGGGGAAATTGTATGG - Intergenic
1131624817 15:94106380-94106402 ATTTCTATGGAGAGAGTCTATGG - Intergenic
1131952739 15:97698690-97698712 AATAATATACATAAAGTGTATGG + Intergenic
1134630846 16:15755038-15755060 ATTTGTATGCATAATGTCTATGG - Intronic
1134752463 16:16636855-16636877 ATATATATCCAGAGAGTATATGG - Intergenic
1135346888 16:21696369-21696391 ATTTGGATGCAGAAGGGGTAAGG + Intronic
1137379990 16:47988738-47988760 ATTAATATGCAAAATATGTAAGG + Intergenic
1138000019 16:53268529-53268551 ATTTATATGCACAAGGAGGAGGG - Intronic
1138425142 16:56926774-56926796 CTTTATACGCAGAATTTGTATGG - Intergenic
1140465473 16:75178004-75178026 ATATATATACTGAAAGTGAAAGG + Intergenic
1143815760 17:9513135-9513157 ATTAATATGCAAAATATGTAAGG + Intronic
1144243941 17:13344552-13344574 ATTTGTATGTAGAATGTTTATGG + Intergenic
1144715124 17:17429039-17429061 ATTTACATGTAAAATGTGTAAGG + Intergenic
1145089173 17:19972371-19972393 ATTTACATCCAGGACGTGTATGG - Intronic
1145413940 17:22697210-22697232 AGTAATATGCAGAATGTGCAGGG - Intergenic
1148585916 17:48780020-48780042 ATTTATTTGCCAAAATTGTACGG + Intronic
1148881787 17:50733764-50733786 ATTTATAGCCATAAACTGTATGG - Intronic
1149132708 17:53324982-53325004 ATTTATTTCAAGAAAGTCTATGG - Intergenic
1149276051 17:55038652-55038674 GGTTATATGCAGAAAGGGCAAGG + Intronic
1150192053 17:63253320-63253342 ATTAATAAGCAGAATGTATAAGG - Intronic
1151138929 17:71973308-71973330 CCTTATTTGCAGAAAGTGTGTGG + Intergenic
1153837820 18:8980077-8980099 ATTTATATGGTCAAAGTTTAGGG - Intergenic
1153852226 18:9106162-9106184 ATTTATATACAGAATGTATAGGG + Intronic
1154421519 18:14234092-14234114 GTTTATTTACAAAAAGTGTATGG + Intergenic
1155865743 18:30962851-30962873 TATTATAAGCAGAAAGTGTATGG - Intergenic
1156777112 18:40805104-40805126 ATTTATATGGATAATATGTATGG - Intergenic
1157109315 18:44805104-44805126 AGTTGTATGGACAAAGTGTAGGG - Intronic
1159142566 18:64415260-64415282 ATTTAGATTGAGAAAGTGCAAGG + Intergenic
1159211612 18:65329728-65329750 ATTTATATTTAGAAACTTTAGGG - Intergenic
1159676998 18:71297309-71297331 ATTTAAATGCTGAAAGAATAGGG + Intergenic
1160054729 18:75467675-75467697 ATTTCCATGCAGACAGTGTGAGG + Intergenic
1163399563 19:17083956-17083978 ATTTAAATACACAAAGTGAATGG + Intronic
1163782394 19:19257394-19257416 AGTGAGATGCAGAAGGTGTACGG + Exonic
1164807294 19:31126908-31126930 ATTTATTTACAGATCGTGTATGG + Intergenic
1165421844 19:35725977-35725999 ATTTATATTCAGAATTTGCATGG + Intronic
1166239555 19:41480631-41480653 AGTTATATGAAGAAACTGGAGGG - Intergenic
1167198203 19:48045143-48045165 ATTTATATGCAGGCATTGTCTGG + Intergenic
1167933723 19:52889849-52889871 ATTAATGTGCACAAAGTGCATGG - Intronic
1168453234 19:56482725-56482747 ATTAATATTCAGAATATGTAAGG - Intergenic
925561616 2:5202367-5202389 ATTGAAATGCACAAAATGTAAGG - Intergenic
925614957 2:5736005-5736027 ATTTTCATGAAGAAAGTGGAGGG - Intergenic
925801511 2:7606714-7606736 CTTTATGTTCAGAAAATGTAAGG - Intergenic
926548967 2:14277897-14277919 TGTAATATGCAGAATGTGTAAGG - Intergenic
926927152 2:17998646-17998668 TTTTATATGCAAAATGTGTAAGG + Intronic
927585011 2:24294898-24294920 CTTCACATGCAGAAAGGGTAAGG - Intronic
927705577 2:25294511-25294533 AGTTATATGCATAAAAGGTAGGG + Intronic
927800697 2:26096318-26096340 ATTCTGATGTAGAAAGTGTAAGG + Intronic
928833170 2:35513210-35513232 AATTATATGAAGAAAGTCAATGG + Intergenic
929216706 2:39421838-39421860 ATTTAAATGGATAAAGTGGAAGG - Intronic
929361223 2:41093621-41093643 AATTATTTGAAGAAAGTTTATGG - Intergenic
929735494 2:44544012-44544034 ATTTTTGTCCAGAAAGTGTATGG - Intronic
930525290 2:52521468-52521490 ATTTATATAAAGAAAATGCATGG + Intergenic
930841327 2:55849675-55849697 ATTTATATTCAGCAATTTTAGGG + Intergenic
931211457 2:60200640-60200662 ATATATGTGCAGAACGTGCAGGG + Intergenic
931580882 2:63772400-63772422 ATTTATATACAGAATCTATAAGG - Intronic
932122065 2:69110918-69110940 ATTTATATGCAGACAGAGACTGG + Intronic
932982217 2:76683052-76683074 ATTTACATGGGGAAAGTATATGG + Intergenic
933284477 2:80370381-80370403 ATTTATATGAATAAAGTAAAAGG - Intronic
934099373 2:88637978-88638000 AATTATAAGCAAAAAGTGCAGGG + Intergenic
934219739 2:90071714-90071736 ATGTATATGCAGAAACCTTAAGG + Intergenic
934496620 2:94807007-94807029 GTTTATTTACAAAAAGTGTATGG - Intergenic
935891149 2:107679862-107679884 CTTTATAGGCAGAATGAGTAGGG + Intergenic
936786804 2:116103206-116103228 AATTATATGAAGAAAGTCAATGG + Intergenic
937745335 2:125405527-125405549 ATTAATAAGCAGAATGTATACGG - Intergenic
938213330 2:129486901-129486923 ATTTATATCCAGAATCTATAAGG + Intergenic
938514998 2:131995062-131995084 GTTTCTATGCAGAAATTGCATGG - Intergenic
939097945 2:137857343-137857365 ACATATATGCATAAAGTATATGG + Intergenic
939124828 2:138165297-138165319 ATTTATATCCAGGAAGGGTGGGG - Intergenic
939327289 2:140709893-140709915 AAATATATGGAGAAAGTGTAGGG + Intronic
939467292 2:142574642-142574664 ATTAATTTGCAGAATGTCTAAGG + Intergenic
939658927 2:144863288-144863310 AAATATATGCAGAATGTGTTAGG - Intergenic
939935421 2:148286506-148286528 ATTTTAATGCAGAGAGTGTTGGG - Intronic
940342152 2:152592572-152592594 ATACATATGCAGAAATAGTAAGG + Intronic
940361220 2:152798223-152798245 ATTTATATAGACAAAGTTTAGGG + Intergenic
941394086 2:164952846-164952868 TATTATATGCAGAAATTGAAGGG - Intronic
943175031 2:184461460-184461482 ATCTATATGCAAAAATAGTATGG - Intergenic
943218803 2:185076544-185076566 ATTTACATTCAGAAAATTTATGG - Intergenic
943804464 2:192105723-192105745 ACATATATGCAGAAAATGGAAGG + Intronic
944566705 2:200998932-200998954 AGATATATGGAGAAAGTGAAGGG - Intronic
944864151 2:203844738-203844760 ATATATATGTAGAAAGTATTAGG - Intergenic
945706952 2:213247541-213247563 ATTTTCAGGCAGAAAGTGTTGGG + Intergenic
946984407 2:225256099-225256121 ATGGATATTCAGAAAGTGTTGGG - Intergenic
947436321 2:230075679-230075701 ATTTATATACAGAAAACATAAGG + Intergenic
1169848842 20:10027737-10027759 ATCTATATGCACAAACAGTATGG + Intronic
1170993335 20:21326087-21326109 TTTTATCTGTAGAAAGTGGATGG - Intronic
1171032291 20:21688134-21688156 ATTTATTTACAGAACGTGTTAGG + Intergenic
1171887918 20:30673739-30673761 GTTTATTTACAAAAAGTGTATGG - Intergenic
1172827484 20:37802766-37802788 ATTTAGATGTATAATGTGTACGG + Intronic
1172988120 20:39009554-39009576 ATGTATATTCAGAAAGCTTAAGG - Intronic
1173936180 20:46867090-46867112 ATTTTTATGCATAATGTGTGTGG + Intergenic
1174665051 20:52250241-52250263 ATTTATATCCAGACATTGAAAGG - Intergenic
1175604606 20:60302351-60302373 AGTTATATGAAGAAAGTGCAGGG - Intergenic
1176312037 21:5156567-5156589 ATTTAGAGGAAGAAAGTGAAGGG - Intergenic
1176778784 21:13167851-13167873 GTTTCTATGCAGAAATTGCATGG + Intergenic
1176851953 21:13925860-13925882 GTTTATTTACAAAAAGTGTACGG - Intergenic
1176961083 21:15159441-15159463 AATTATAAGTAGAAAGTGTTTGG - Intergenic
1177216249 21:18133132-18133154 ATGTCTATGCAGAAACTTTAAGG + Intronic
1177371629 21:20211422-20211444 CTTTATAAGCAGATATTGTAAGG - Intergenic
1177373917 21:20242475-20242497 AATTAAATGCAGATAGTTTATGG - Intergenic
1177392274 21:20491274-20491296 CTTAATACGCAGGAAGTGTAAGG - Intergenic
1177591016 21:23167901-23167923 AATTATATGAAGAAAGTCAATGG + Intergenic
1177976423 21:27856978-27857000 GTTTCTATGCAGAAATTGCATGG + Intergenic
1179708844 21:43199299-43199321 ATTAAAATGCAGAAACTGTCAGG + Intergenic
1179845011 21:44105463-44105485 ATTTAGAGGAAGAAAGTGAAGGG + Exonic
1180572673 22:16743033-16743055 AATTATGTGCAGAATGTCTATGG + Intergenic
1183148508 22:36017871-36017893 ATTTAACTGCAGAATGTGTTGGG - Intronic
949595709 3:5544734-5544756 ATGTATAGGCTGAAAGTGAAGGG - Intergenic
950035874 3:9885357-9885379 ATTTATATGTAGATAGAGTAGGG - Intergenic
952197981 3:31096215-31096237 ATTTAGGTACAGAAAGGGTAGGG - Intergenic
952257972 3:31711828-31711850 ATTTAAATGGATAAATTGTATGG + Intronic
952594413 3:34998773-34998795 ATTTACATGCAGAAGATGGAAGG - Intergenic
952947643 3:38490132-38490154 ATTTTTAGGCAGAGAGTGGATGG + Exonic
954025898 3:47782580-47782602 AGCGCTATGCAGAAAGTGTATGG - Intergenic
955030967 3:55217657-55217679 ATTAATATCCAGAATGTATAAGG - Intergenic
956349427 3:68318356-68318378 CATTATATGCAGAAATTGGAAGG + Intronic
956444302 3:69310448-69310470 AATTATCTGCAGAAAGTGGAAGG + Intronic
956831745 3:73056488-73056510 ATTGATTTGCAGAAAGTGTTTGG + Intronic
957105014 3:75875865-75875887 AATTATGTGCAGAATGTCTATGG - Intergenic
957975501 3:87438478-87438500 TTGTATATGCACAAAGTGCAAGG - Intergenic
958054600 3:88393118-88393140 ATATATCTGCAGATAGTGTGAGG + Intergenic
958156463 3:89761768-89761790 ATTTTTATACAGGAAGGGTAGGG + Intergenic
958580342 3:96010558-96010580 ATGTATATCCAGAAAATGCATGG + Intergenic
958615286 3:96486349-96486371 AGTTCTATACAGAAAGTATATGG + Intergenic
958701550 3:97597767-97597789 ATTTTTATTCAGAAAGTATATGG + Intronic
958705775 3:97653272-97653294 ATTAATATGCAAAATATGTAAGG + Intronic
958794639 3:98693763-98693785 ATTTATATGCTCCAAGTGTGGGG - Intergenic
958973693 3:100641244-100641266 ATTTATATAAACAAAGTTTAGGG + Intronic
958989016 3:100820007-100820029 ACCTATATGCAGAAAATGCAAGG + Intronic
959501538 3:107111874-107111896 ATTTATTTGGAGAAAGGGTCAGG + Intergenic
959721827 3:109500127-109500149 TTTTATTTGCAGAAAATGTGAGG - Intergenic
959963227 3:112324639-112324661 ATTTATCTGCAGGACATGTAAGG + Intergenic
960018608 3:112922015-112922037 ATTTATATGCAGAAACCTAATGG + Intronic
961014934 3:123460414-123460436 ATTGAGATGCCGAAAGTGTTAGG + Intergenic
962132821 3:132700276-132700298 ATTTAGATTCAGAAATTGTTGGG - Intronic
962473956 3:135739727-135739749 ATTCAAATGCATAAAGTGGAGGG - Intergenic
962906398 3:139807185-139807207 ACTAACATGCAGAAAGTATAAGG + Intergenic
963586474 3:147196323-147196345 ATTTATAGGAAGATAGTTTATGG - Intergenic
963879324 3:150511016-150511038 ATTAATATCCAGAAAATATAAGG + Intergenic
963943819 3:151123174-151123196 CTTGATATGCAGAATGTTTAGGG - Intronic
965192576 3:165550343-165550365 GTTTTTATGCAGAAAGTGGAAGG + Intergenic
965873315 3:173286431-173286453 ATTTATATGCATAAGTTGTTTGG - Intergenic
966363635 3:179157150-179157172 ATTTATATGCATAAAAGTTAGGG - Intronic
967601732 3:191398580-191398602 ACATATTTACAGAAAGTGTATGG - Intronic
969241675 4:5902835-5902857 ATTTAGGTTCAGAAAGTTTAAGG + Intronic
969906024 4:10396627-10396649 ATCTATGTCCAGAAAGTGTGGGG + Intergenic
970154663 4:13129698-13129720 ATTTTAATACAGAAAGTATATGG + Intergenic
970333510 4:15006311-15006333 ATTTATTTGTAGTAACTGTATGG + Intronic
971051101 4:22863557-22863579 ATTTGTAGGAAGAAAGTTTAAGG + Intergenic
972233180 4:37099122-37099144 ATTTGCATGCAGGAAGTTTATGG + Intergenic
973922410 4:55701431-55701453 ATATATATGCAGAAATGGCATGG - Intergenic
974602162 4:64097410-64097432 ATTTGCATGCAGAAAGTTTATGG - Intergenic
975139792 4:70907285-70907307 TTTTATATGCACAAAATGTCAGG - Intronic
975482420 4:74895794-74895816 ATTTATATGGAGTAATTTTACGG - Intergenic
976955403 4:90891754-90891776 ATTTATGTGAAAAAAGTGTAAGG + Intronic
977256621 4:94748031-94748053 GTCTATATTCAGAAAGTCTAAGG + Intergenic
978800270 4:112749476-112749498 AGTTATATTCAGAAAATGTATGG + Intergenic
978976867 4:114887926-114887948 ATTTAAATGCAAAAATTATAAGG - Intronic
980032975 4:127851792-127851814 ACTAATATTCAGAATGTGTAAGG + Intergenic
980772419 4:137393953-137393975 ATTTGTTTGTTGAAAGTGTATGG + Intergenic
981070927 4:140537468-140537490 ATTTGGATGTAGAAAGTGTGAGG + Exonic
981513669 4:145584622-145584644 ATTTACTTGCAAAATGTGTAGGG + Intergenic
982216788 4:153089276-153089298 ATTTCTTTGCAGGAAGTGTAAGG + Intergenic
983016256 4:162616784-162616806 ATTTAAATGTAGAAAATGTCAGG + Intergenic
983135685 4:164076995-164077017 AATTCTATGAAGAAAGTCTATGG - Intronic
983366380 4:166795611-166795633 AATTAATTTCAGAAAGTGTATGG - Intronic
983881120 4:172934393-172934415 CTTTTTATGCAGAAACTATAAGG + Intronic
984064515 4:175031756-175031778 CTTTATATGCAAAAACTATAAGG - Intergenic
984285454 4:177722959-177722981 ATCTAAATACAGAAAATGTACGG + Intergenic
984318874 4:178165233-178165255 ATTTATATGAATATAGTGTTTGG - Intergenic
984321711 4:178205839-178205861 ATATAAATGTAGAAAGTGAAAGG + Intergenic
985021861 4:185700157-185700179 ATTTATATGGAATAAGTCTAAGG + Intronic
986941868 5:12962371-12962393 TTATATATGCAAAATGTGTAAGG + Intergenic
986944136 5:12994405-12994427 TTTTAAATGGATAAAGTGTATGG - Intergenic
986965375 5:13264152-13264174 CTGTATATGCAGAAAGAGTAAGG - Intergenic
987634215 5:20518779-20518801 ATCCATATGCAGCAAGAGTATGG + Intronic
987860125 5:23474927-23474949 ATGAATATGCAGTAAGTATAAGG - Intergenic
987875239 5:23673406-23673428 ATACATATACAGAAAGTATATGG + Intergenic
988029222 5:25740525-25740547 ATTAATATGCAGAATATATAAGG + Intergenic
988705583 5:33723250-33723272 GTTTATATGCAGCAAATATAAGG - Intronic
989005053 5:36800921-36800943 ATTTACATGCAGGAGGTTTATGG - Intergenic
990079463 5:51895400-51895422 ATATATATGAGGAAAATGTAGGG + Intergenic
990350935 5:54915375-54915397 GTTTATATGCAGAAGGTTAAAGG - Intergenic
990427873 5:55706372-55706394 ATTAATTTCCAGAAAGTGAAAGG - Intronic
991234049 5:64373636-64373658 ATTTTTATTCAGAAGGTGTAGGG + Intergenic
991265927 5:64717429-64717451 ATTTATATGGAGTGAGTGAATGG + Intronic
992229394 5:74649117-74649139 ATTTGAATGCAGAAACTTTAGGG - Intronic
992659885 5:78948569-78948591 ATTTATATGCAGTAAGAACATGG + Intronic
993734321 5:91458119-91458141 ATTTTCCTGCAGAAAGTGTCTGG - Intergenic
994110536 5:95998203-95998225 ATACATAAGCAGAAAATGTATGG - Intergenic
994131529 5:96234643-96234665 ATTTCTATGCAGAAAGAAAAGGG + Intergenic
994141759 5:96348914-96348936 AATTATGAGCAGAAAGTGCAAGG + Intergenic
994543930 5:101138609-101138631 ATTCATATGAAAAAAGAGTATGG - Intergenic
994802627 5:104398383-104398405 ATTTCTATGAAGAAAGTCAATGG - Intergenic
994803095 5:104405047-104405069 ATTTATATTTAAAATGTGTAAGG + Intergenic
995628514 5:114107057-114107079 ATTTTTATGCATGAAGTCTAAGG + Intergenic
995631452 5:114137586-114137608 TTTTATATGCAGAAATGGCATGG + Intergenic
996104091 5:119478361-119478383 ATTTATTTTCAGAAACTGTCAGG - Intronic
996211142 5:120812329-120812351 ATTAATATCCAGAATCTGTAAGG - Intergenic
998513757 5:142735004-142735026 ATTTATCTGCAGAAAGGAGAAGG + Intergenic
999882752 5:155885079-155885101 ATTGATATCCAGAAAGTCTAAGG + Intronic
999940211 5:156534198-156534220 ATTTACATGAAGAAATTGTCTGG + Intronic
1000271790 5:159692184-159692206 ATTAATATCCAGAATATGTAAGG + Intergenic
1000549194 5:162637883-162637905 ATCTGCATGTAGAAAGTGTATGG - Intergenic
1000671535 5:164068996-164069018 ATTTAAATGGAAGAAGTGTAGGG + Intergenic
1003029600 6:2590235-2590257 ATTAATATGCAAAATATGTAAGG - Intergenic
1005606455 6:27482970-27482992 ATTTAAATGCAAAAAGTACAAGG + Intergenic
1008234251 6:49025450-49025472 ATCTATATCCAGAATGTGTGGGG + Intergenic
1008358203 6:50581179-50581201 TCTTCTATGCAGAAAGTGAATGG - Intergenic
1010246536 6:73664617-73664639 ATTTATAAGCAGAATATATAAGG + Intergenic
1010415162 6:75603138-75603160 ATTTATCTGGAAAAAGAGTAAGG + Intronic
1010465126 6:76158626-76158648 AATTATATGAAGAAAGTCAATGG + Intergenic
1012789097 6:103670223-103670245 ATTTATACTCATAAAGTATATGG + Intergenic
1013442743 6:110187820-110187842 ATTAAAATGCAGTAAGTGAAGGG - Intronic
1013859535 6:114618628-114618650 ATTTATATTCTCAAAGTGTCAGG - Intergenic
1013924588 6:115455025-115455047 ATTTAAATGCAAAAAGTAGATGG + Intergenic
1014478641 6:121907221-121907243 ATTAATATACAGAATATGTAAGG - Intergenic
1014560224 6:122880828-122880850 AATTCTATGCAGAAAGTCAATGG + Intergenic
1015934932 6:138399534-138399556 TTTTATTTGCAGAAAATCTAAGG - Intergenic
1016326184 6:142904606-142904628 ATTTTCATTCAGAAAGAGTATGG - Intronic
1016571558 6:145519302-145519324 ATTTAACTCCAGAAAGTGAATGG + Intronic
1016872099 6:148828043-148828065 ATTAAGATTCAGAAAGTGAATGG - Intronic
1017073016 6:150593158-150593180 ATTTAAATGCAGAAATATTAAGG - Intergenic
1018114453 6:160570120-160570142 ATATATATCCAGTAATTGTATGG - Intronic
1018518486 6:164615803-164615825 ATTTATATCCAGAATATATAAGG - Intergenic
1019909527 7:4091086-4091108 GTTTATATGCAAAAATTTTAAGG - Intronic
1020506398 7:8994263-8994285 CATTATATGCAAAAAGTATAGGG - Intergenic
1020658185 7:10952128-10952150 ATGTATAAGCAGAAAGTTTTAGG - Intergenic
1020659799 7:10968378-10968400 CTTGATATGTAGAAAATGTAAGG - Intergenic
1020732696 7:11903645-11903667 ATTAATATCCAGAATATGTAAGG + Intergenic
1021052917 7:16011459-16011481 ATTTATATGCAGAAAACATTTGG + Intergenic
1022890050 7:34687934-34687956 ATTTAAAAGCAGAAACTGGAAGG + Intronic
1024414584 7:49089815-49089837 ATTTATCTGCAGTTAGTGGAAGG - Intergenic
1024800169 7:53068047-53068069 ATTTATATTCAGTGCGTGTAAGG - Intergenic
1024945288 7:54801895-54801917 ATTTATATACAGGAGGTGGATGG - Intergenic
1027410198 7:77908235-77908257 GTTTATGTCCAGAAAGTCTAAGG + Intronic
1027414384 7:77959515-77959537 ATTTATATAGACAAAGTTTAGGG - Intergenic
1027652166 7:80881785-80881807 ATTAATATGAAGACAGTGTGAGG + Intronic
1027697266 7:81427308-81427330 GCTTATATGCACAAAGTGTCTGG + Intergenic
1027766768 7:82353808-82353830 ATTTCTATGCAAAAAGAGAAAGG + Intronic
1029556191 7:101270983-101271005 ATTTATCTGAAGAAAGAGAAAGG + Intergenic
1029881292 7:103813157-103813179 ATTAATATGTAGAAAGAGAAAGG - Intronic
1030645035 7:112051375-112051397 ATGTATATGCAGAAATTTTAAGG - Intronic
1031800864 7:126243340-126243362 ATTTGTATGCAGTAGATGTAAGG - Intergenic
1032998991 7:137482091-137482113 ATTTTTATGTAGAAAGTGACTGG - Intronic
1034048697 7:147958888-147958910 ATTTTTTTGCAGTAAGTGTAGGG + Intronic
1034731872 7:153394179-153394201 TTTTACATGCAGGATGTGTAAGG + Intergenic
1035495057 7:159317451-159317473 ATTTATGGGCAGAAAATGGAAGG - Intergenic
1035966636 8:4199282-4199304 ATTGATATGCAGGCAGTGTATGG + Intronic
1035995549 8:4542184-4542206 ATTTTTATTCAGAAAGTTTGAGG - Intronic
1037277123 8:17192502-17192524 ATTAATATCCAGAATGTATAAGG - Intronic
1038418038 8:27411960-27411982 ATTTATATGATAAAACTGTAAGG - Intronic
1038929751 8:32179680-32179702 TTTAATATTCAGAAAGTGTTTGG + Intronic
1039378739 8:37064414-37064436 ACTTAAATTCAGGAAGTGTAAGG - Intergenic
1040452323 8:47560486-47560508 ACTTATAAGCAGAAACTGGAAGG - Intronic
1040812404 8:51469748-51469770 ATATATATCCTGAAAGTGCATGG - Intronic
1041172340 8:55156863-55156885 TTGTTTATGCAGAAAGTTTACGG - Intronic
1041175272 8:55190385-55190407 ATTTCTTTTCAGAAAGTGTGAGG + Intronic
1041819419 8:62013065-62013087 TTTTATGGGCAGAAAGTATAAGG - Intergenic
1041921024 8:63181084-63181106 ATTTATATGCACAAATTACATGG - Intronic
1042458427 8:69033080-69033102 ATTTGTAGTCAGAAATTGTAGGG - Intergenic
1042737140 8:72002151-72002173 ATTTATAGGAAGCAGGTGTAAGG + Intronic
1042767517 8:72341514-72341536 ATTTATATGAAAAAATTGCAAGG + Intergenic
1043032419 8:75153652-75153674 ATTAATATGAATAAAGTATATGG + Intergenic
1044489399 8:92794162-92794184 AATCAAATGCTGAAAGTGTAAGG + Intergenic
1044588195 8:93887745-93887767 ATTTGTATCCAGAATATGTAAGG + Intronic
1044844417 8:96366254-96366276 ATTTATGTGCAGAAAGTTTATGG + Intergenic
1045783133 8:105891345-105891367 ATTAATATGCAGAATATGTAAGG + Intergenic
1046523202 8:115351705-115351727 ATTTATTTGGAGAAAGAGTCTGG - Intergenic
1046552423 8:115733444-115733466 ATTTATATACAGAGAGAGAAGGG - Intronic
1048096104 8:131296714-131296736 ATTCATATCCAGAATATGTAAGG - Intergenic
1048520102 8:135145967-135145989 ATCCATATGCAGAAAGAGAATGG - Intergenic
1050241909 9:3645499-3645521 ATTTGAATTCAGAAAGTCTAGGG + Intergenic
1050782814 9:9359792-9359814 ATTTTTATTCAGCAGGTGTACGG + Intronic
1050838988 9:10122672-10122694 ATTTAGATGCATAAATTTTAAGG - Intronic
1050921493 9:11207210-11207232 AATTATATGTGGAAAGTTTATGG - Intergenic
1051095538 9:13461500-13461522 TTTTTTATGCTGAAAGTGTTAGG + Intergenic
1051433208 9:17001942-17001964 ATTTGTAGGGACAAAGTGTAGGG + Intergenic
1051842228 9:21412078-21412100 ATTTATATGCAGTCAGGGAATGG + Intronic
1051954191 9:22670043-22670065 AATTATATGGAGAAAAGGTAGGG - Intergenic
1051966886 9:22838871-22838893 ATTTATATTCAAAATATGTAAGG - Intergenic
1053660529 9:40273434-40273456 GTTTATTTACAAAAAGTGTATGG + Intronic
1053910904 9:42902778-42902800 GTTTATTTACAAAAAGTGTATGG + Intergenic
1054313815 9:63559727-63559749 ATTTATCTTCATAAAGTGTTTGG + Intergenic
1054361535 9:64126352-64126374 GTTTATTTACAAAAAGTGTATGG + Intergenic
1054372649 9:64419652-64419674 GTTTATTTACAAAAAGTGTATGG + Intergenic
1054524082 9:66102850-66102872 GTTTATTTACAAAAAGTGTATGG - Intergenic
1054680276 9:67909427-67909449 GTTTATTTACAAAAAGTGTATGG + Intergenic
1055902053 9:81251529-81251551 ATTTGTATGTGGATAGTGTAAGG + Intergenic
1056136767 9:83637444-83637466 ATTTATCTTCAGTAAGTGCAAGG - Intronic
1057333726 9:94140469-94140491 ATTTGTATGCAGAAAATAGAGGG + Intergenic
1057634663 9:96752956-96752978 ATTTGTATGCAGGAGGTGTTCGG + Intergenic
1059610103 9:115883459-115883481 AGTTATATGAAGAAAGTAAAGGG + Intergenic
1059813575 9:117885143-117885165 ATTTCTATCCAAAAAGTGTTTGG + Intergenic
1060559799 9:124533591-124533613 AGTTCTGTGAAGAAAGTGTAAGG + Intronic
1189176413 X:38962328-38962350 ATTAATATCCAGAATCTGTAAGG - Intergenic
1189592327 X:42527597-42527619 ATTTATATACAGAAAGAGAATGG - Intergenic
1191074920 X:56442460-56442482 ATGCATATGCAGAAGGTGCAGGG - Intergenic
1191227608 X:58061018-58061040 ATTTATAACCAGAATGTATAAGG - Intergenic
1192659251 X:73024484-73024506 ATATATATGCTGAAAGTGATGGG - Intergenic
1193945678 X:87730440-87730462 ATTTAAATGGACAAAGTGAATGG + Intergenic
1193974981 X:88106808-88106830 ATTTACAAGGACAAAGTGTATGG + Intergenic
1194003689 X:88464182-88464204 ATTTATATGTAGATTGTGAAAGG + Intergenic
1194087522 X:89547055-89547077 ATTTAAATGCATAAATTGTATGG + Intergenic
1194172218 X:90601527-90601549 ATCTATGTTCAGAAAGAGTAAGG - Intergenic
1194441050 X:93934797-93934819 ATTAATAGTCAGAATGTGTAAGG - Intergenic
1195392916 X:104381745-104381767 AATCATCTGCTGAAAGTGTAAGG - Intergenic
1195790356 X:108577868-108577890 ATTTAGTTTCAGAAAGAGTAAGG - Intronic
1196357174 X:114808845-114808867 ATTAATAAGCAGAATGTATAAGG - Intronic
1196962506 X:121018542-121018564 ATTTATATCCAGCAAGTCCATGG + Intergenic
1198184679 X:134241950-134241972 TTTTTTATGCAGAACGAGTATGG - Intronic
1198701296 X:139400264-139400286 AGTTATCTGCAGAAAATGGAAGG - Intergenic
1199337359 X:146634562-146634584 ATTTATTTGCAGAAATTGATAGG + Intergenic
1199423915 X:147679050-147679072 ATTAATTTTCAGAATGTGTATGG - Intergenic
1200440167 Y:3202926-3202948 ATTTAAATGCATAAATTGTATGG + Intergenic
1200518450 Y:4179264-4179286 ATCTATGTTCAGAAAGAGTAAGG - Intergenic
1201055748 Y:9988848-9988870 AACCATATGCAAAAAGTGTAAGG - Intergenic
1201570906 Y:15413357-15413379 ACTTGTATGCAGAATATGTAAGG + Intergenic