ID: 1070223636

View in Genome Browser
Species Human (GRCh38)
Location 10:74477340-74477362
Sequence GTTTACGGGTGCATGCCACC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070223629_1070223636 -1 Left 1070223629 10:74477318-74477340 CCTCAGCCTCCCGAGTAGCTGGG 0: 97626
1: 275854
2: 227041
3: 130261
4: 162635
Right 1070223636 10:74477340-74477362 GTTTACGGGTGCATGCCACCAGG No data
1070223631_1070223636 -7 Left 1070223631 10:74477324-74477346 CCTCCCGAGTAGCTGGGTTTACG 0: 3
1: 674
2: 49253
3: 216965
4: 258761
Right 1070223636 10:74477340-74477362 GTTTACGGGTGCATGCCACCAGG No data
1070223634_1070223636 -10 Left 1070223634 10:74477327-74477349 CCCGAGTAGCTGGGTTTACGGGT 0: 2
1: 437
2: 32946
3: 155972
4: 258318
Right 1070223636 10:74477340-74477362 GTTTACGGGTGCATGCCACCAGG No data
1070223626_1070223636 3 Left 1070223626 10:74477314-74477336 CCCACCTCAGCCTCCCGAGTAGC 0: 6037
1: 125141
2: 279269
3: 199503
4: 138471
Right 1070223636 10:74477340-74477362 GTTTACGGGTGCATGCCACCAGG No data
1070223625_1070223636 6 Left 1070223625 10:74477311-74477333 CCTCCCACCTCAGCCTCCCGAGT 0: 2427
1: 22969
2: 41666
3: 78900
4: 130303
Right 1070223636 10:74477340-74477362 GTTTACGGGTGCATGCCACCAGG No data
1070223623_1070223636 22 Left 1070223623 10:74477295-74477317 CCCAGGCACAAGCGATCCTCCCA 0: 21
1: 1325
2: 12578
3: 41211
4: 74000
Right 1070223636 10:74477340-74477362 GTTTACGGGTGCATGCCACCAGG No data
1070223627_1070223636 2 Left 1070223627 10:74477315-74477337 CCACCTCAGCCTCCCGAGTAGCT 0: 6083
1: 36071
2: 47989
3: 39959
4: 95342
Right 1070223636 10:74477340-74477362 GTTTACGGGTGCATGCCACCAGG No data
1070223624_1070223636 21 Left 1070223624 10:74477296-74477318 CCAGGCACAAGCGATCCTCCCAC 0: 10
1: 1322
2: 9112
3: 17776
4: 25975
Right 1070223636 10:74477340-74477362 GTTTACGGGTGCATGCCACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070223636 Original CRISPR GTTTACGGGTGCATGCCACC AGG Intronic
No off target data available for this crispr