ID: 1070229868

View in Genome Browser
Species Human (GRCh38)
Location 10:74554095-74554117
Sequence CAGAGTATAAGAAGCTACCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 134}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070229868_1070229869 6 Left 1070229868 10:74554095-74554117 CCATGGTAGCTTCTTATACTCTG 0: 1
1: 0
2: 1
3: 6
4: 134
Right 1070229869 10:74554124-74554146 TACTCTTTCTTGTGATAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070229868 Original CRISPR CAGAGTATAAGAAGCTACCA TGG (reversed) Intronic
905231510 1:36517376-36517398 CAGAGTAAAAGAGGGTACTAGGG - Intergenic
905848812 1:41257872-41257894 CAGAGTGTCTGAAGCAACCAGGG - Intergenic
910482879 1:87677313-87677335 CATAGTATTAGAAGATAACATGG - Intergenic
910629795 1:89342989-89343011 CAAAGTATAGGAGGCTACCCAGG + Intergenic
914218146 1:145652991-145653013 CAGAATATAAGAAATAACCAAGG - Intronic
914470704 1:147975672-147975694 CAGAATATAAGAAATAACCAAGG - Intronic
916311101 1:163399741-163399763 GAGAGTAAAAGAAGCTCCCATGG + Intergenic
916910365 1:169340036-169340058 CAGAGTAAGAGAAACTAACAAGG - Intronic
919745115 1:201003979-201004001 CATAGTAAAGGCAGCTACCAAGG + Intronic
920073001 1:203316642-203316664 CTCAGTCTAAGAGGCTACCAGGG + Intergenic
923774335 1:236965164-236965186 AAAAATCTAAGAAGCTACCAGGG + Intergenic
1063529088 10:6813062-6813084 CAGATTCTAAGAAACTTCCAGGG + Intergenic
1070229868 10:74554095-74554117 CAGAGTATAAGAAGCTACCATGG - Intronic
1070553090 10:77506402-77506424 CTAAGTATAAGAAGCCAACAAGG - Intronic
1070940392 10:80340166-80340188 AAGAGAATCAGATGCTACCAGGG - Intronic
1071439658 10:85679137-85679159 CAGAGTTTCAGAAGCCTCCAGGG + Intronic
1071736269 10:88303936-88303958 CAGAGTATTAGCAGATGCCAGGG - Intronic
1074886338 10:117696696-117696718 CATGGTAAAAGAAGCCACCATGG + Intergenic
1076016470 10:127031572-127031594 AACATTATAAGAAGCTACAAAGG - Intronic
1081306792 11:41522169-41522191 CATAATATTAGAAGCTAACATGG - Intergenic
1085041997 11:73331963-73331985 CATAGTGAAAGGAGCTACCATGG + Intronic
1085255481 11:75170308-75170330 CAGAGTCTAGGAAACTGCCAGGG + Intronic
1086097950 11:83069460-83069482 CAGAGGAGAAGAAACAACCAGGG + Intronic
1089222762 11:116888677-116888699 CAGAGAATGAGAAACAACCAGGG - Intronic
1090909022 11:131102233-131102255 CAGATCATAAGATGCTTCCACGG - Intergenic
1092877031 12:12857267-12857289 CAGTGTATAATATGCTATCATGG + Intergenic
1096743573 12:53711613-53711635 CTGTGTATCAGAAGCAACCAGGG + Intronic
1097776345 12:63651429-63651451 CATAGCAAAAGAAACTACCAAGG + Intronic
1098572449 12:72003965-72003987 CAGAGAATAAAGAGTTACCAAGG - Intronic
1100441158 12:94618340-94618362 GGGAATATATGAAGCTACCAGGG - Intronic
1100748250 12:97669123-97669145 CAGAGAATTAGAAGTTACTAGGG - Intergenic
1101190190 12:102324712-102324734 TAGAGTATAACAAGCTAAAAGGG + Intergenic
1101819560 12:108173440-108173462 CAGAGAATCAGAAGCTTCTATGG + Intronic
1102380631 12:112463410-112463432 TAGTGTTAAAGAAGCTACCATGG - Intronic
1106296344 13:28417468-28417490 CAGATTATAAGCACCTCCCATGG + Intronic
1107923733 13:45237697-45237719 TAGAGTAAAAGAATGTACCATGG - Intronic
1111192378 13:84826114-84826136 CAGAGCAGGAGAAGCTATCAAGG - Intergenic
1115182242 14:30642498-30642520 CTGAGTATAAGAATCACCCAGGG - Intronic
1119445107 14:74656810-74656832 CAGAGGATAAGTAACTGCCAAGG - Intronic
1120066919 14:80053006-80053028 AAGAGACTAAGAAGCTACCAAGG + Intergenic
1120544099 14:85788774-85788796 CAAAGTATGAAAACCTACCAAGG - Intergenic
1121429076 14:93874142-93874164 GAGAGTAGAAGAAGGTACCCTGG - Intergenic
1127714138 15:61631747-61631769 TAGAGTAAAAGAAGCTATGAAGG - Intergenic
1128288503 15:66458879-66458901 CAAGGTATAATAAGCTACTATGG - Intronic
1131149059 15:90035554-90035576 CATCATTTAAGAAGCTACCAGGG - Intronic
1135206307 16:20487334-20487356 TAGGGTATAAGAAGGTGCCACGG - Exonic
1135591612 16:23708952-23708974 CAGAGTATAGGAAACCACAAGGG - Intronic
1142374210 16:89698394-89698416 CTGAGCATCAGAAGCTGCCAAGG - Intronic
1143572544 17:7769069-7769091 CAGAGAACAAGAAGCCAGCAAGG - Intronic
1144707345 17:17378261-17378283 CAGGGTCTAAGAGGCTACCCAGG - Intergenic
1148938766 17:51188490-51188512 CAGAATATGATAACCTACCAAGG + Intronic
1150514302 17:65791401-65791423 CTGATTATCAGAAGCAACCAGGG - Intronic
1153977861 18:10285235-10285257 CAGAGTCTCAGAAGCTAAAAAGG - Intergenic
1155839303 18:30627416-30627438 CAAAGAACAAGAAGCTACCCAGG - Intergenic
1157241642 18:46015374-46015396 CTGAGCATAAGAACATACCAGGG + Intronic
1158582612 18:58697975-58697997 CATAATATGAGAAGCTACTAAGG + Intronic
1159334434 18:67044442-67044464 CATACCATAAGAAGCTTCCATGG - Intergenic
1159341256 18:67136549-67136571 TAGAGAATGAAAAGCTACCAAGG + Intergenic
1160196934 18:76763276-76763298 AATATTAAAAGAAGCTACCAAGG - Intergenic
1160238873 18:77108115-77108137 CAGAGTGTCAGAAGCTAATAAGG - Intronic
1161759377 19:6160087-6160109 CAGAGTATAAAAATCTCGCAGGG + Intronic
1162739370 19:12765364-12765386 GAGAGTAGAAGAAGCTAGCAAGG - Intronic
1165613794 19:37180623-37180645 AACAGTATAAGAAGCTGTCAAGG + Intronic
926845978 2:17139519-17139541 CAGAGTAAAGGAGGCTACCTGGG + Intergenic
928011556 2:27612932-27612954 GGGAGTATATGAAACTACCATGG + Intronic
928137832 2:28701837-28701859 CAATGTATAAGAAACAACCAGGG + Intergenic
929336622 2:40755565-40755587 CTGTGAATAAGAAACTACCAAGG - Intergenic
930092742 2:47543153-47543175 CTGTGAATAAGGAGCTACCAGGG + Intronic
933108909 2:78372612-78372634 CATATTAAAAGAAGTTACCATGG + Intergenic
933487573 2:82942560-82942582 CAGATTTTAAGAATTTACCAGGG + Intergenic
934289408 2:91678445-91678467 CAGACTGTGAGAAGCTACTAGGG - Intergenic
935864250 2:107368187-107368209 CACAGTAAAAGAAACTATCAAGG + Intergenic
940804673 2:158173372-158173394 CCGAGTCTAAGGAGCTACTAGGG + Intronic
941887743 2:170547017-170547039 CAGAGTATAAGAAGTGTCCCTGG + Intronic
942084311 2:172429267-172429289 CAGAGTATAAGCAGCTGGCCAGG - Intronic
1168870186 20:1120824-1120846 CAGAGTCTAAGTAGCTAGCTAGG - Intronic
1169455841 20:5751598-5751620 CATAGTATAAGAAGATAGCCGGG - Intronic
1171151508 20:22830542-22830564 CTCAGTATAAGAAGCCATCATGG - Intergenic
1175519954 20:59595849-59595871 CAGAGCAAGAGAAGCTACCAGGG - Intronic
1177660465 21:24076032-24076054 TAGAGTATGAGAAGCTTCAAGGG - Intergenic
1178796829 21:35752618-35752640 CAGAGGAGAAGCAGCAACCAGGG + Intronic
1179203166 21:39246021-39246043 AACAGTAAAAGAAGCTACTAAGG + Intronic
1182242863 22:28931001-28931023 CAGAGTATAACAGGCAGCCAAGG + Intronic
953397770 3:42586666-42586688 CAGAGGAAAAGAAGCTGCAATGG - Intronic
954072212 3:48151221-48151243 CAGAGTCTAGGAAGCCGCCAGGG + Intergenic
955549374 3:60067080-60067102 CACAGCATAAGAAGATACCCAGG + Intronic
956340632 3:68219828-68219850 CAGAATTTAAGATGCTCCCAAGG - Intronic
961845061 3:129755801-129755823 CAGTTTATAAGAAACTGCCAAGG + Intronic
966991861 3:185240732-185240754 TATAGTATAAGAAGATACAAAGG - Intronic
968297353 3:197587025-197587047 TAGAGTATAAGAACCCAACACGG + Intergenic
968439350 4:613963-613985 CAGAGCAAAGAAAGCTACCAGGG - Intergenic
973601375 4:52545961-52545983 CCGAGCATAAAAAGCTATCAAGG + Intergenic
975010973 4:69351069-69351091 AGGAATATAAGAGGCTACCATGG - Intronic
975249735 4:72164738-72164760 CACAGCAAAAGAAACTACCATGG - Intergenic
975255607 4:72231831-72231853 CACAGCAAAAGAAACTACCATGG - Intergenic
975451530 4:74532715-74532737 CAAAGTAGAAGAAGGTAGCAGGG + Intergenic
979502177 4:121453325-121453347 AAGCATATAAGTAGCTACCACGG + Intergenic
980238959 4:130147868-130147890 CAGACTAGAGGAAGGTACCATGG - Intergenic
981328317 4:143477873-143477895 CAGAGTACAGTAATCTACCATGG - Intergenic
989708428 5:44366569-44366591 GAGAGATTAACAAGCTACCAAGG + Intronic
993373198 5:87117780-87117802 AGGAGGATGAGAAGCTACCAGGG - Intergenic
998928799 5:147157607-147157629 CAGAGTTTACCCAGCTACCAAGG + Intergenic
1004190855 6:13462254-13462276 GAGAGAATAAGAAGCAAACAAGG + Intronic
1006258252 6:32848109-32848131 CACACGATAAGAGGCTACCAAGG + Intronic
1007681509 6:43636742-43636764 GAGAGAATAAGCAGCTTCCAGGG + Intronic
1008030184 6:46687013-46687035 CAGACTATAAGAAGCTTCCACGG + Intergenic
1009335722 6:62488651-62488673 CAGAGTGTATGAAGCTGTCAAGG + Intergenic
1009693323 6:67064383-67064405 AAGACTATAAAAAGCTACAAAGG - Intergenic
1013746506 6:113352589-113352611 CAGAGTGTAGGAAGCCAACAAGG - Intergenic
1013948401 6:115750424-115750446 CAGAGAATATGAAACTATCAAGG - Intergenic
1014312201 6:119817846-119817868 AAGAATTTCAGAAGCTACCAAGG - Intergenic
1017344298 6:153362015-153362037 CAGTGTATCAGATGCTTCCAAGG + Intergenic
1024448782 7:49514214-49514236 CAGAGAACAGGAAGTTACCAAGG + Intergenic
1025809050 7:64862549-64862571 AAAAGTACAAGAAGCTACAAGGG + Intergenic
1029969720 7:104777354-104777376 CAGGGTTCAAGAAGTTACCAGGG + Intronic
1031939702 7:127775219-127775241 CAGAGATTAAGATGCTAACAGGG - Intronic
1032699232 7:134364133-134364155 CAGAGTATAGGGAGCCAGCAAGG - Intergenic
1034359771 7:150484337-150484359 CAGAGAATATGAAACTACAAGGG - Intergenic
1034371711 7:150603840-150603862 CAGAGAATATGAAACTACAAGGG - Intergenic
1034379380 7:150677111-150677133 CAGAGAATATGAAACTACAAGGG - Intergenic
1039633319 8:39135951-39135973 CTGAAAATAAGAAGCAACCAGGG - Intronic
1040864305 8:52032776-52032798 CCGAGTGTAAGAAACCACCAGGG + Intergenic
1041402352 8:57459133-57459155 CAGAGTGAAAAAAGCTTCCAAGG - Intergenic
1044328909 8:90893292-90893314 AAAAGTAAAAGGAGCTACCATGG - Intronic
1046488413 8:114916103-114916125 AAGAGAATATGAAGCCACCATGG + Intergenic
1047375092 8:124288473-124288495 GAGAGTATAAGCTGCTCCCATGG + Intergenic
1047753866 8:127903394-127903416 CAGAGCAAAAGAAACTATCAAGG - Intergenic
1048325936 8:133438947-133438969 CAGAGTATAAGAAGCCAGGTAGG - Intergenic
1050835257 9:10069249-10069271 CAGAATATAAGAAGGCAACAAGG + Intronic
1051986246 9:23091132-23091154 CAAAGTCTAAAAAGCTAGCATGG + Intergenic
1054804118 9:69381562-69381584 CAGAGTTTCAGAACCTCCCAAGG + Intronic
1055401091 9:75924898-75924920 CAGAGTGTAAGAACCTGCCCGGG - Intronic
1056032784 9:82570289-82570311 CAGAGTAGAAGGAACTACCAGGG - Intergenic
1058329185 9:103737430-103737452 CAGATTATAACCAGCTATCAAGG - Intergenic
1059584254 9:115589126-115589148 CAAAGTATAAGTAGCCCCCAAGG + Intergenic
1188367110 X:29330327-29330349 CAGAGTTTTAGATGCTACCTTGG - Intronic
1189202721 X:39211531-39211553 CAGGCTATAAGAAGCTAGTAAGG - Intergenic
1190522971 X:51298901-51298923 CACAGTAGAAGAAGGCACCAGGG + Intergenic
1192096251 X:68214316-68214338 CAGAGAATAAGAAATTAACAAGG + Intronic
1193693578 X:84679715-84679737 CAGCCTACAAGAAGCTACCATGG + Intergenic
1195719529 X:107853041-107853063 TAGAGGAAAAGCAGCTACCAGGG + Intronic
1200388741 X:155920362-155920384 CATAGTATAAGCAGCTCACAAGG - Intronic