ID: 1070235011

View in Genome Browser
Species Human (GRCh38)
Location 10:74615137-74615159
Sequence CTCTTTCTCATACAAGGGTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 109}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070235011 Original CRISPR CTCTTTCTCATACAAGGGTA TGG (reversed) Intronic
903586508 1:24419625-24419647 CTCCTTCTCCTACAAGGCAAGGG + Exonic
906837507 1:49099950-49099972 CTCTCTCTCATTCTAGGGTGTGG + Intronic
909837278 1:80272647-80272669 TTCTTTCTCACACAAGCCTATGG + Intergenic
911335850 1:96579063-96579085 CTCTTTCTCCTCCTAGGGTCTGG - Intergenic
921487181 1:215728962-215728984 CCATTTATCATAGAAGGGTAAGG - Intronic
924897278 1:248354727-248354749 CTCTTTCTCATAAAGTGGAAGGG + Intergenic
1063655605 10:7985460-7985482 CTTTTTCTCATACAGAGGGAAGG - Intronic
1064205801 10:13322593-13322615 CTCTTTTTGATGCAAGGATATGG - Intronic
1067030109 10:42874175-42874197 CTCTTTCTGGCACAAGGTTAGGG - Intergenic
1070235011 10:74615137-74615159 CTCTTTCTCATACAAGGGTATGG - Intronic
1076211821 10:128653933-128653955 CTCTTTAAAATACAAAGGTATGG - Intergenic
1081431221 11:42978522-42978544 CTATTTCTTATACAAAGTTACGG - Intergenic
1089818928 11:121203839-121203861 CACTGTCTCATAAAAGGTTATGG - Intergenic
1091440302 12:507667-507689 CACTTTCTCACAAAAGGGTAGGG + Intronic
1093360888 12:18226285-18226307 CTCTGTCTCAAAAAAGGGAAGGG + Intronic
1095690937 12:45087775-45087797 CTTTTTCTCATACTTGGGTTAGG + Intergenic
1099417570 12:82410846-82410868 CTTTGTCTCATTCAAGGGTATGG - Intronic
1099921384 12:88961600-88961622 CTCTATCTCATAGAAAAGTAGGG + Intergenic
1100654532 12:96627229-96627251 TTCTTTCTCACACAAGGTTTTGG + Intronic
1103447475 12:121003743-121003765 CTGTTTCTCACACCAGGCTAAGG + Intronic
1108346406 13:49551090-49551112 CTCTGTCTCAAAAAAGGGAAGGG + Intronic
1111095863 13:83515050-83515072 CTGTTTCTTATACCAGGGTAAGG - Intergenic
1112898880 13:104335645-104335667 CACTTTCTCAGGCAAGGTTAAGG + Intergenic
1113267728 13:108637949-108637971 CTCTGTCTCACACACTGGTATGG - Intronic
1116090883 14:40305325-40305347 TTCTTCCTCATACAAGTGTTTGG - Intergenic
1119037650 14:71244179-71244201 CTCTTACTAAAACAAGGGCAGGG + Intergenic
1120886837 14:89458319-89458341 GTGTTTCTAATACAAGGATAAGG - Intronic
1122801165 14:104230300-104230322 CTCTGGCTCTTACAAGGGGAAGG + Intergenic
1124415224 15:29468028-29468050 CTCTTTCTCCTGCAAGTGGATGG + Intronic
1127886345 15:63204854-63204876 CTTTTTCTTATACAAGGATGAGG + Intronic
1128010190 15:64286729-64286751 CTCTTTCAAATAAAAGGCTAGGG - Intronic
1130847059 15:87757417-87757439 CTCTTTCTCAAACAGAGGCAAGG - Intergenic
1131861940 15:96663039-96663061 ATCTCTTTCATGCAAGGGTAAGG + Intergenic
1132113396 15:99118467-99118489 CTCATTCACATGCAAGGGAAGGG + Intronic
1135779752 16:25289989-25290011 ATCCTTCTCATACAATGATACGG + Intergenic
1140028875 16:71318024-71318046 TTCTTTCTCATAAATGGTTAGGG + Intergenic
1140303355 16:73779723-73779745 CTCTTTCTCAAAAAAAGGAAAGG - Intergenic
1146683941 17:34827737-34827759 CCCTTTCCCATACAAGTGAAAGG - Intergenic
1150045671 17:61910897-61910919 CTCATTCACTCACAAGGGTACGG + Intronic
1156750759 18:40451931-40451953 ATCTTTCTCATACACTGGAATGG + Intergenic
1164700178 19:30279480-30279502 CTCTTTCTCAGACAACGCTGGGG - Intronic
1167042019 19:47028045-47028067 CTCTTCCCCATACACGGGTCCGG - Intronic
1167300014 19:48672773-48672795 CTCTTTCTTAAAGAGGGGTATGG - Intronic
926450930 2:13002868-13002890 CTATTTCTCATACATGGTTTTGG + Intergenic
928210914 2:29322964-29322986 CTCTGCCTCCTAAAAGGGTAAGG - Intronic
929698655 2:44142270-44142292 ATCTTTCTAATAGAAGGCTATGG + Intergenic
932072390 2:68634409-68634431 CTCTTTCTCTTACAAGGACATGG - Intergenic
932171795 2:69564323-69564345 CTCCCTCCCTTACAAGGGTAGGG + Intronic
932615649 2:73229760-73229782 GCCTATCTCATAGAAGGGTAGGG - Intronic
934735781 2:96689202-96689224 CTGATTCTCATACTAGGGGAGGG - Intergenic
939762250 2:146197714-146197736 TTTTTTCCCATACACGGGTAGGG + Intergenic
942931236 2:181495897-181495919 TTGTTTCTCATATAAGGGCAAGG + Exonic
943837810 2:192536713-192536735 CTCTCTCTCAGAAAAGTGTATGG - Intergenic
944282500 2:197913845-197913867 TTCCTTTTCATAAAAGGGTAGGG + Intronic
944819433 2:203415111-203415133 CTCTTTCTCACCCAAGTATATGG + Intronic
945221330 2:207487392-207487414 CTCATTCTTTTACAAGTGTACGG + Intergenic
945996182 2:216438285-216438307 CACTTTCTCATTCAAGGAGATGG - Intronic
1168745100 20:232708-232730 TTCTTTCTCACACAAGTCTAAGG + Intergenic
1173362715 20:42359199-42359221 CACTTTCTCAGGCAAGGGGATGG + Intronic
1181879280 22:25964905-25964927 GTTTTTTTCCTACAAGGGTAGGG - Intronic
1183442752 22:37832540-37832562 CTCTTTCTGATACGAGTGTCTGG + Intronic
949265825 3:2155306-2155328 CTCTGTCTCTTACAGGGGTGTGG + Intronic
952476405 3:33715265-33715287 CTCTTTCTAATGCAATGGCAGGG + Intronic
952790827 3:37199319-37199341 CTCTCTCTCATTCAAGGCAAAGG - Intergenic
955299548 3:57764195-57764217 CTCTTTCTTAAACAGGGGTTTGG - Intronic
956510497 3:69988408-69988430 CCCTTTCTGATTCAAGGGGAGGG + Intergenic
956967438 3:74478385-74478407 CTTATTCTCAAAAAAGGGTAAGG + Intronic
957017043 3:75078689-75078711 CTCTCACTCATACAAAGGTCAGG + Intergenic
957737186 3:84217135-84217157 CTCATTCCCATACAATTGTATGG - Intergenic
962070598 3:132029610-132029632 CTCTTTCTTATCCAAGTGTAGGG - Intronic
971642699 4:29156347-29156369 CCCTTTCTCATTCAAGGGTTAGG - Intergenic
972282529 4:37616612-37616634 CTCATTCTAAGACAAGGCTATGG + Intronic
973914226 4:55617198-55617220 CTTTTTCTCATACCAGGGGGCGG + Intronic
976029359 4:80732417-80732439 TGCTGTCTCATACAAGGGTTAGG + Intronic
976797028 4:88945489-88945511 TTCTTTCTCTTGGAAGGGTAAGG + Intronic
977672994 4:99717058-99717080 CTCTTTCTCCTCCAAGTGCAGGG + Intergenic
979080125 4:116328440-116328462 CTCTTTCACATAGAAAGTTAAGG + Intergenic
980566737 4:134552271-134552293 CCCTTTCTCATTCAAGGCTAGGG - Intergenic
981881177 4:149614608-149614630 CTCTTCCTCATTCTAGGGCATGG + Intergenic
982955488 4:161760340-161760362 CTCTCTCACATACAAAGGCAGGG + Intronic
989277550 5:39607522-39607544 CTCTCTCACATTCAAGGGTTTGG - Intergenic
989319936 5:40122338-40122360 GTCTTCCTCAAACAAGGGAAAGG - Intergenic
989549674 5:42719345-42719367 CTCTTTGTCAGGCAAGGGCAAGG - Exonic
992266398 5:75022561-75022583 CTCTTTCTCATTAAAGGGGAGGG - Intergenic
995007806 5:107221769-107221791 CTCTTTGTCGTAGAAGGGGAGGG - Intergenic
995885078 5:116885310-116885332 CTCTTTCTCATACAAGGTTCGGG + Intergenic
998585103 5:143419281-143419303 CTCTTTCTCTTCCAAGGACACGG + Intronic
1000187110 5:158869850-158869872 CTCTTTCTCATTCAAAAGAAAGG - Intronic
1004531195 6:16457076-16457098 ATCTTTATAGTACAAGGGTAAGG + Intronic
1014951843 6:127565288-127565310 ATCTTACTCATACAAGATTATGG + Intronic
1015361034 6:132339733-132339755 CTCTTTCACATCCAGGGGAAAGG - Intronic
1017030319 6:150215141-150215163 CTCTTTCTCATACAACTGTGGGG - Intronic
1018889298 6:167971476-167971498 CTCTTACTCAAACAAGGAAATGG - Intronic
1018937170 6:168281093-168281115 CTCTTTGTCATCCACGGGTGGGG + Intergenic
1020587398 7:10086183-10086205 CTGTTATTCATACAAAGGTAGGG - Intergenic
1020849538 7:13333733-13333755 CTCTTTCTGATGGGAGGGTAAGG - Intergenic
1023146023 7:37151849-37151871 CTCTTTCTCTGTCAAGGGTCAGG + Intronic
1032594819 7:133228818-133228840 CTCTTTCTCTTAAAAGTGAAAGG - Intergenic
1037137837 8:15484556-15484578 CTCTTTCTCATTCCGGTGTAGGG + Intronic
1037206919 8:16334055-16334077 CTATTTCTCATAAAAGGGTAGGG + Intronic
1038249115 8:25886275-25886297 CTTTTTCTAAGAGAAGGGTATGG - Intronic
1038695323 8:29801466-29801488 CTCTTTCACCTACAAGGGCATGG - Intergenic
1041349734 8:56936298-56936320 CTCTTTCTCTTAGAAAAGTAGGG + Intergenic
1044152034 8:88791919-88791941 CTCTTTCTTATAAATGGGAAAGG + Intergenic
1044941549 8:97348930-97348952 CTCTTTCTCTTCCAAGGGCTGGG - Intergenic
1045149547 8:99388790-99388812 CACTTTCTAACACAAGAGTAAGG - Intronic
1047231987 8:123005352-123005374 CTCTGTCTCATAAATGGGAATGG + Intergenic
1047246241 8:123147470-123147492 TTCTTTCTAAAACAAGGGTAAGG - Intronic
1049060167 8:140270521-140270543 CTCTTTCTCTAATCAGGGTATGG - Intronic
1051237872 9:15020893-15020915 CTCTTTTTTATATAAGGGTATGG + Intergenic
1052198657 9:25749482-25749504 CTCTTTGTCAAACAAAGGTTTGG + Intergenic
1052679677 9:31673306-31673328 GCCTTTCTCATACATGGGTTTGG - Intergenic
1054753570 9:68933656-68933678 CTCTTCCTCATACATGTGGATGG + Intronic
1057413874 9:94844307-94844329 CTTTTTTTCTTAAAAGGGTATGG - Intronic
1059386294 9:113967463-113967485 CTGTTTCCCACACAAGGGAAAGG - Intronic
1060806318 9:126579531-126579553 CTCTTTCTAAAACTAGGATATGG + Intergenic
1061202140 9:129143973-129143995 CTCTTTGGCACACAAGGGTTGGG - Intronic
1061641616 9:131962110-131962132 CTCTATCTCAGACTAGTGTATGG - Intronic
1186467168 X:9792686-9792708 TTCTTACTCATAGAAGGGAAGGG + Intronic
1189184463 X:39041281-39041303 CTGTTTACCATACAAGGATAAGG - Intergenic
1191847011 X:65554504-65554526 CCCTTTGTCCTACAAGGGTCTGG + Intergenic
1194115653 X:89893539-89893561 TTGTTTCTCATACTAGGGCAGGG - Intergenic
1199800185 X:151242900-151242922 TTCTTTCTCATACAGGTGTGTGG + Intergenic
1200468446 Y:3550674-3550696 TTGTTTCTCATACTAGGGCAGGG - Intergenic