ID: 1070236712

View in Genome Browser
Species Human (GRCh38)
Location 10:74635132-74635154
Sequence TGGGAAGCCCTGTGAACCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070236709_1070236712 10 Left 1070236709 10:74635099-74635121 CCACTTCTGGTGAAAGACATGAA 0: 1
1: 0
2: 1
3: 31
4: 322
Right 1070236712 10:74635132-74635154 TGGGAAGCCCTGTGAACCACAGG No data
1070236708_1070236712 11 Left 1070236708 10:74635098-74635120 CCCACTTCTGGTGAAAGACATGA 0: 1
1: 0
2: 0
3: 26
4: 285
Right 1070236712 10:74635132-74635154 TGGGAAGCCCTGTGAACCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070236712 Original CRISPR TGGGAAGCCCTGTGAACCAC AGG Intronic
No off target data available for this crispr