ID: 1070245817

View in Genome Browser
Species Human (GRCh38)
Location 10:74730468-74730490
Sequence CTGTGATGGGAGGAGTGTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070245817_1070245828 23 Left 1070245817 10:74730468-74730490 CCAGGACACTCCTCCCATCACAG No data
Right 1070245828 10:74730514-74730536 CTTGTTTTAGAGATCAGGCTGGG No data
1070245817_1070245827 22 Left 1070245817 10:74730468-74730490 CCAGGACACTCCTCCCATCACAG No data
Right 1070245827 10:74730513-74730535 ACTTGTTTTAGAGATCAGGCTGG No data
1070245817_1070245826 18 Left 1070245817 10:74730468-74730490 CCAGGACACTCCTCCCATCACAG No data
Right 1070245826 10:74730509-74730531 ACAGACTTGTTTTAGAGATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070245817 Original CRISPR CTGTGATGGGAGGAGTGTCC TGG (reversed) Intergenic
No off target data available for this crispr