ID: 1070245817 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 10:74730468-74730490 |
| Sequence | CTGTGATGGGAGGAGTGTCC TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1070245817_1070245828 | 23 | Left | 1070245817 | 10:74730468-74730490 | CCAGGACACTCCTCCCATCACAG | No data | ||
| Right | 1070245828 | 10:74730514-74730536 | CTTGTTTTAGAGATCAGGCTGGG | No data | ||||
| 1070245817_1070245827 | 22 | Left | 1070245817 | 10:74730468-74730490 | CCAGGACACTCCTCCCATCACAG | No data | ||
| Right | 1070245827 | 10:74730513-74730535 | ACTTGTTTTAGAGATCAGGCTGG | No data | ||||
| 1070245817_1070245826 | 18 | Left | 1070245817 | 10:74730468-74730490 | CCAGGACACTCCTCCCATCACAG | No data | ||
| Right | 1070245826 | 10:74730509-74730531 | ACAGACTTGTTTTAGAGATCAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1070245817 | Original CRISPR | CTGTGATGGGAGGAGTGTCC TGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||